FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628590_at:

>probe:Drosophila_2:1628590_at:449:47; Interrogation_Position=1037; Antisense; ATCCGGAGTCGGAGGCACACCAGGA
>probe:Drosophila_2:1628590_at:266:75; Interrogation_Position=1079; Antisense; AGGAGCAGGCAGTCACCGAGGAATC
>probe:Drosophila_2:1628590_at:636:237; Interrogation_Position=1100; Antisense; AATCTGCCGCTGAGGATTCCCAGAA
>probe:Drosophila_2:1628590_at:427:369; Interrogation_Position=1122; Antisense; GAATGAGATCAACCTCCAAGCCGAA
>probe:Drosophila_2:1628590_at:545:209; Interrogation_Position=1165; Antisense; AAGAATCGCAAGCTCAGCTCCATTG
>probe:Drosophila_2:1628590_at:627:623; Interrogation_Position=1188; Antisense; TGCCGAGCACATCCTGATGCAGTAG
>probe:Drosophila_2:1628590_at:261:167; Interrogation_Position=770; Antisense; AAATGCCCGCCGAAGAGCAGATTGC
>probe:Drosophila_2:1628590_at:334:465; Interrogation_Position=789; Antisense; GATTGCCGATTTTATGTTCGCCTTT
>probe:Drosophila_2:1628590_at:10:305; Interrogation_Position=837; Antisense; CCGACGCCGATTTGTCTGCGAAATG
>probe:Drosophila_2:1628590_at:107:217; Interrogation_Position=874; Antisense; AAGTTGAATCCCTTGACCAGCATGG
>probe:Drosophila_2:1628590_at:499:263; Interrogation_Position=891; Antisense; CAGCATGGCTTTCCGCATTGTGGGT
>probe:Drosophila_2:1628590_at:113:715; Interrogation_Position=908; Antisense; TTGTGGGTCGCGGTTTCTTTGAGAA
>probe:Drosophila_2:1628590_at:712:489; Interrogation_Position=933; Antisense; GTACACCAATGCCAGAAATCCTATG
>probe:Drosophila_2:1628590_at:560:493; Interrogation_Position=991; Antisense; GTCAATCCCGAGTGCATTTTCGTGG

Paste this into a BLAST search page for me
ATCCGGAGTCGGAGGCACACCAGGAAGGAGCAGGCAGTCACCGAGGAATCAATCTGCCGCTGAGGATTCCCAGAAGAATGAGATCAACCTCCAAGCCGAAAAGAATCGCAAGCTCAGCTCCATTGTGCCGAGCACATCCTGATGCAGTAGAAATGCCCGCCGAAGAGCAGATTGCGATTGCCGATTTTATGTTCGCCTTTCCGACGCCGATTTGTCTGCGAAATGAAGTTGAATCCCTTGACCAGCATGGCAGCATGGCTTTCCGCATTGTGGGTTTGTGGGTCGCGGTTTCTTTGAGAAGTACACCAATGCCAGAAATCCTATGGTCAATCCCGAGTGCATTTTCGTGG

Full Affymetrix probeset data:

Annotations for 1628590_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720