Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628591_at:

>probe:Drosophila_2:1628591_at:339:435; Interrogation_Position=1024; Antisense; GAGGTGACCTACGACGATTTGCAAA
>probe:Drosophila_2:1628591_at:110:177; Interrogation_Position=1079; Antisense; AAACCCTGCGTTTGATACCATCTGT
>probe:Drosophila_2:1628591_at:87:41; Interrogation_Position=1098; Antisense; ATCTGTTCCATTCACACCGAGGGAA
>probe:Drosophila_2:1628591_at:493:19; Interrogation_Position=1133; Antisense; ATTTCCGTCTATCCTCTGGAGTGGT
>probe:Drosophila_2:1628591_at:211:459; Interrogation_Position=1186; Antisense; GATATATTTGCTACCCATCGCAACC
>probe:Drosophila_2:1628591_at:391:697; Interrogation_Position=1255; Antisense; TTTCTGCCCGACAATGTGCGCGATA
>probe:Drosophila_2:1628591_at:716:457; Interrogation_Position=1276; Antisense; GATAGGCATCCTTACGCATACATTC
>probe:Drosophila_2:1628591_at:174:375; Interrogation_Position=1414; Antisense; GAAGATCTCGAGTTCGTTGACAACA
>probe:Drosophila_2:1628591_at:163:229; Interrogation_Position=1443; Antisense; AATGGAACTAGCTCAGTCACCTGGA
>probe:Drosophila_2:1628591_at:323:495; Interrogation_Position=1458; Antisense; GTCACCTGGACTAGAATTTCATCGG
>probe:Drosophila_2:1628591_at:75:503; Interrogation_Position=898; Antisense; GTCGCTGCCTTTGAGACAACTGGTG
>probe:Drosophila_2:1628591_at:503:511; Interrogation_Position=920; Antisense; GTGACACGGTGTATCACGCACTCAT
>probe:Drosophila_2:1628591_at:187:559; Interrogation_Position=972; Antisense; GGACACGGTCTATCAGGAGCTCAAA
>probe:Drosophila_2:1628591_at:125:117; Interrogation_Position=989; Antisense; AGCTCAAAGAGCTGTTTCCCGTGGC

Paste this into a BLAST search page for me
GAGGTGACCTACGACGATTTGCAAAAAACCCTGCGTTTGATACCATCTGTATCTGTTCCATTCACACCGAGGGAAATTTCCGTCTATCCTCTGGAGTGGTGATATATTTGCTACCCATCGCAACCTTTCTGCCCGACAATGTGCGCGATAGATAGGCATCCTTACGCATACATTCGAAGATCTCGAGTTCGTTGACAACAAATGGAACTAGCTCAGTCACCTGGAGTCACCTGGACTAGAATTTCATCGGGTCGCTGCCTTTGAGACAACTGGTGGTGACACGGTGTATCACGCACTCATGGACACGGTCTATCAGGAGCTCAAAAGCTCAAAGAGCTGTTTCCCGTGGC

Full Affymetrix probeset data:

Annotations for 1628591_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime