Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628592_at:

>probe:Drosophila_2:1628592_at:632:169; Interrogation_Position=1023; Antisense; AAAGGGCTCAGCACTTCTGTGGTAC
>probe:Drosophila_2:1628592_at:272:241; Interrogation_Position=1075; Antisense; AATAGAACAGCCCACTCAGCTTGTC
>probe:Drosophila_2:1628592_at:154:335; Interrogation_Position=545; Antisense; GCTGCAGTTCGGAATGTCGACCTAC
>probe:Drosophila_2:1628592_at:607:411; Interrogation_Position=563; Antisense; GACCTACCGCGAAACTTTATTGCTT
>probe:Drosophila_2:1628592_at:554:147; Interrogation_Position=598; Antisense; ACATCCTCGTATTTCCTTCGATTGG
>probe:Drosophila_2:1628592_at:579:637; Interrogation_Position=615; Antisense; TCGATTGGCCCCTCTGAAGATGGAA
>probe:Drosophila_2:1628592_at:422:375; Interrogation_Position=630; Antisense; GAAGATGGAACTGCTGTCCCTCGAT
>probe:Drosophila_2:1628592_at:575:45; Interrogation_Position=653; Antisense; ATCCCTACATGGTGCTCTTTCATGA
>probe:Drosophila_2:1628592_at:683:623; Interrogation_Position=732; Antisense; TGCCCGAACCGTTACCGTGAGTAAG
>probe:Drosophila_2:1628592_at:448:245; Interrogation_Position=763; Antisense; AATTATACAGAGGACCCCGATCGCA
>probe:Drosophila_2:1628592_at:140:45; Interrogation_Position=782; Antisense; ATCGCACCACCAAGGGTACATGGCT
>probe:Drosophila_2:1628592_at:98:365; Interrogation_Position=908; Antisense; GAATAGGCGGTTTCTACGGCATCCA
>probe:Drosophila_2:1628592_at:10:141; Interrogation_Position=923; Antisense; ACGGCATCCACTTTGACTTTTTAGA
>probe:Drosophila_2:1628592_at:414:361; Interrogation_Position=955; Antisense; GAATTGAGTGACGTGCCCCAAGGTG

Paste this into a BLAST search page for me
AAAGGGCTCAGCACTTCTGTGGTACAATAGAACAGCCCACTCAGCTTGTCGCTGCAGTTCGGAATGTCGACCTACGACCTACCGCGAAACTTTATTGCTTACATCCTCGTATTTCCTTCGATTGGTCGATTGGCCCCTCTGAAGATGGAAGAAGATGGAACTGCTGTCCCTCGATATCCCTACATGGTGCTCTTTCATGATGCCCGAACCGTTACCGTGAGTAAGAATTATACAGAGGACCCCGATCGCAATCGCACCACCAAGGGTACATGGCTGAATAGGCGGTTTCTACGGCATCCAACGGCATCCACTTTGACTTTTTAGAGAATTGAGTGACGTGCCCCAAGGTG

Full Affymetrix probeset data:

Annotations for 1628592_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime