FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628593_at:

>probe:Drosophila_2:1628593_at:442:327; Interrogation_Position=130; Antisense; GCGTTGTGCGCACCAACCTAAATAT
>probe:Drosophila_2:1628593_at:17:163; Interrogation_Position=149; Antisense; AAATATACCACTATCCTTTTGCGAA
>probe:Drosophila_2:1628593_at:206:377; Interrogation_Position=179; Antisense; GAACGTCTGGAAATTCTCGAACACT
>probe:Drosophila_2:1628593_at:683:161; Interrogation_Position=210; Antisense; ACAATGATATTCTTCTTCACCCTCA
>probe:Drosophila_2:1628593_at:525:729; Interrogation_Position=238; Antisense; TTGGTATCCTTCGAGCGTTCTCAAA
>probe:Drosophila_2:1628593_at:88:461; Interrogation_Position=270; Antisense; GATTTCATGAACCTTTTCTTCGGAG
>probe:Drosophila_2:1628593_at:325:719; Interrogation_Position=344; Antisense; TTCGCGCCGCTTTCAAGTCATCAAA
>probe:Drosophila_2:1628593_at:700:343; Interrogation_Position=428; Antisense; GCATTACATGGTTCCCTTCGTTGTG
>probe:Drosophila_2:1628593_at:490:597; Interrogation_Position=449; Antisense; TGTGCTTTCGTTGATCATCTTGATC
>probe:Drosophila_2:1628593_at:358:453; Interrogation_Position=470; Antisense; GATCATCTATGTGTTCGTCGTGGCA
>probe:Drosophila_2:1628593_at:143:61; Interrogation_Position=511; Antisense; ATGTCGGGATACCACTGGACCGCAA
>probe:Drosophila_2:1628593_at:597:149; Interrogation_Position=562; Antisense; ACTTGAGCTGTGTTGTTTACGTGCA
>probe:Drosophila_2:1628593_at:190:359; Interrogation_Position=599; Antisense; GCAACAGATCTTCTCTTAGTGGACG
>probe:Drosophila_2:1628593_at:111:491; Interrogation_Position=70; Antisense; GTACAAACTTACCTCATTTCGCAAT

Paste this into a BLAST search page for me
GCGTTGTGCGCACCAACCTAAATATAAATATACCACTATCCTTTTGCGAAGAACGTCTGGAAATTCTCGAACACTACAATGATATTCTTCTTCACCCTCATTGGTATCCTTCGAGCGTTCTCAAAGATTTCATGAACCTTTTCTTCGGAGTTCGCGCCGCTTTCAAGTCATCAAAGCATTACATGGTTCCCTTCGTTGTGTGTGCTTTCGTTGATCATCTTGATCGATCATCTATGTGTTCGTCGTGGCAATGTCGGGATACCACTGGACCGCAAACTTGAGCTGTGTTGTTTACGTGCAGCAACAGATCTTCTCTTAGTGGACGGTACAAACTTACCTCATTTCGCAAT

Full Affymetrix probeset data:

Annotations for 1628593_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720