Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628594_at:

>probe:Drosophila_2:1628594_at:329:663; Interrogation_Position=6960; Antisense; TAAATTTGGGCAGCCTCTATCACCG
>probe:Drosophila_2:1628594_at:536:205; Interrogation_Position=7079; Antisense; AAGCCCAATCGCATTTGGCTCCGGT
>probe:Drosophila_2:1628594_at:666:17; Interrogation_Position=7091; Antisense; ATTTGGCTCCGGTTCAGTTTCAGTC
>probe:Drosophila_2:1628594_at:495:349; Interrogation_Position=7158; Antisense; GCAGGTGGAGCGTTAAACACTCAAA
>probe:Drosophila_2:1628594_at:177:155; Interrogation_Position=7174; Antisense; ACACTCAAACGTTGTTATTGCTATA
>probe:Drosophila_2:1628594_at:485:351; Interrogation_Position=7325; Antisense; GCAGAGGCACTTAAAGCTGCTCTAA
>probe:Drosophila_2:1628594_at:505:663; Interrogation_Position=7336; Antisense; TAAAGCTGCTCTAAGGCACCCCTAG
>probe:Drosophila_2:1628594_at:470:317; Interrogation_Position=7351; Antisense; GCACCCCTAGATGTAAGCCCGTTTA
>probe:Drosophila_2:1628594_at:351:599; Interrogation_Position=7362; Antisense; TGTAAGCCCGTTTACTTTACTGTGG
>probe:Drosophila_2:1628594_at:21:695; Interrogation_Position=7377; Antisense; TTTACTGTGGCTAGATCATGCCTAG
>probe:Drosophila_2:1628594_at:182:627; Interrogation_Position=7395; Antisense; TGCCTAGCAGGTATTAACTCATATA
>probe:Drosophila_2:1628594_at:626:255; Interrogation_Position=7485; Antisense; CACGTAGTCATTGGTTACCCCGTCG
>probe:Drosophila_2:1628594_at:222:249; Interrogation_Position=7512; Antisense; AATTGGCCCAGTTAAGCGTTCCAGT
>probe:Drosophila_2:1628594_at:312:293; Interrogation_Position=7528; Antisense; CGTTCCAGTTACTATACCGCGTGAA

Paste this into a BLAST search page for me
TAAATTTGGGCAGCCTCTATCACCGAAGCCCAATCGCATTTGGCTCCGGTATTTGGCTCCGGTTCAGTTTCAGTCGCAGGTGGAGCGTTAAACACTCAAAACACTCAAACGTTGTTATTGCTATAGCAGAGGCACTTAAAGCTGCTCTAATAAAGCTGCTCTAAGGCACCCCTAGGCACCCCTAGATGTAAGCCCGTTTATGTAAGCCCGTTTACTTTACTGTGGTTTACTGTGGCTAGATCATGCCTAGTGCCTAGCAGGTATTAACTCATATACACGTAGTCATTGGTTACCCCGTCGAATTGGCCCAGTTAAGCGTTCCAGTCGTTCCAGTTACTATACCGCGTGAA

Full Affymetrix probeset data:

Annotations for 1628594_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime