Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628595_at:

>probe:Drosophila_2:1628595_at:118:241; Interrogation_Position=1137; Antisense; AATAATTCTCTGATCTGTTCTATAA
>probe:Drosophila_2:1628595_at:291:13; Interrogation_Position=1172; Antisense; ATTAATGTGCACATCTTTGCCGCTG
>probe:Drosophila_2:1628595_at:150:151; Interrogation_Position=1182; Antisense; ACATCTTTGCCGCTGGGTGGGTCAC
>probe:Drosophila_2:1628595_at:88:519; Interrogation_Position=1198; Antisense; GTGGGTCACCAGAAGGTTGAGCCAA
>probe:Drosophila_2:1628595_at:387:79; Interrogation_Position=1211; Antisense; AGGTTGAGCCAAAGGCCATGCCCGC
>probe:Drosophila_2:1628595_at:392:323; Interrogation_Position=1234; Antisense; GCGCCCCATTGAGCATGTGGTGTTA
>probe:Drosophila_2:1628595_at:641:613; Interrogation_Position=1265; Antisense; TGAACCCAGGTTCTGTTTCATTAAT
>probe:Drosophila_2:1628595_at:64:479; Interrogation_Position=1279; Antisense; GTTTCATTAATTTACGTGCAGTCGC
>probe:Drosophila_2:1628595_at:485:507; Interrogation_Position=1294; Antisense; GTGCAGTCGCATTTACTTGCAGGCT
>probe:Drosophila_2:1628595_at:6:723; Interrogation_Position=1310; Antisense; TTGCAGGCTCTTTCTTAAACAGTAC
>probe:Drosophila_2:1628595_at:257:489; Interrogation_Position=1331; Antisense; GTACTGTTGTTTTCCATTTCAAGCT
>probe:Drosophila_2:1628595_at:198:491; Interrogation_Position=1547; Antisense; GTAAATCATGCCTAGACTGAAGAAT
>probe:Drosophila_2:1628595_at:670:489; Interrogation_Position=1579; Antisense; GTAATTTACCCTAGATTGATTGAGA
>probe:Drosophila_2:1628595_at:395:47; Interrogation_Position=1636; Antisense; ATCCATTTTTTAAGGCTCTGTCTAA

Paste this into a BLAST search page for me
AATAATTCTCTGATCTGTTCTATAAATTAATGTGCACATCTTTGCCGCTGACATCTTTGCCGCTGGGTGGGTCACGTGGGTCACCAGAAGGTTGAGCCAAAGGTTGAGCCAAAGGCCATGCCCGCGCGCCCCATTGAGCATGTGGTGTTATGAACCCAGGTTCTGTTTCATTAATGTTTCATTAATTTACGTGCAGTCGCGTGCAGTCGCATTTACTTGCAGGCTTTGCAGGCTCTTTCTTAAACAGTACGTACTGTTGTTTTCCATTTCAAGCTGTAAATCATGCCTAGACTGAAGAATGTAATTTACCCTAGATTGATTGAGAATCCATTTTTTAAGGCTCTGTCTAA

Full Affymetrix probeset data:

Annotations for 1628595_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime