Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628599_at:

>probe:Drosophila_2:1628599_at:627:471; Interrogation_Position=296; Antisense; GTTCTTTACCAAAATGCCCTGTGAG
>probe:Drosophila_2:1628599_at:94:419; Interrogation_Position=318; Antisense; GAGCATTACATGGTAGTGGCCCAGT
>probe:Drosophila_2:1628599_at:522:57; Interrogation_Position=348; Antisense; ATGAGCACGGCTCCGGATGACGTTC
>probe:Drosophila_2:1628599_at:228:419; Interrogation_Position=384; Antisense; GAGCTGCGCACTGTGATCAAGGACA
>probe:Drosophila_2:1628599_at:697:225; Interrogation_Position=402; Antisense; AAGGACATCTTCGACATACGCGAGT
>probe:Drosophila_2:1628599_at:120:717; Interrogation_Position=440; Antisense; TTCGATCGACGCCTTTATCAAGGGA
>probe:Drosophila_2:1628599_at:431:677; Interrogation_Position=484; Antisense; TAGACAACCTCACGCTTCTGGAGAT
>probe:Drosophila_2:1628599_at:119:589; Interrogation_Position=502; Antisense; TGGAGATCCACAGCGTGAGACCCAT
>probe:Drosophila_2:1628599_at:376:7; Interrogation_Position=535; Antisense; ATTCCCTGGACCACATAGCACGGTA
>probe:Drosophila_2:1628599_at:91:223; Interrogation_Position=584; Antisense; AAGGGACACCTCCATGCTAAGTGCA
>probe:Drosophila_2:1628599_at:498:655; Interrogation_Position=601; Antisense; TAAGTGCATCCATGGCAGGCTCCAG
>probe:Drosophila_2:1628599_at:710:693; Interrogation_Position=626; Antisense; TTCGGGTCCGAACAGTAACTCTCTG
>probe:Drosophila_2:1628599_at:39:493; Interrogation_Position=640; Antisense; GTAACTCTCTGTTTTCTCAGTGATT
>probe:Drosophila_2:1628599_at:517:487; Interrogation_Position=731; Antisense; GTAGCCTGTAGTCATTAAACCTCTC

Paste this into a BLAST search page for me
GTTCTTTACCAAAATGCCCTGTGAGGAGCATTACATGGTAGTGGCCCAGTATGAGCACGGCTCCGGATGACGTTCGAGCTGCGCACTGTGATCAAGGACAAAGGACATCTTCGACATACGCGAGTTTCGATCGACGCCTTTATCAAGGGATAGACAACCTCACGCTTCTGGAGATTGGAGATCCACAGCGTGAGACCCATATTCCCTGGACCACATAGCACGGTAAAGGGACACCTCCATGCTAAGTGCATAAGTGCATCCATGGCAGGCTCCAGTTCGGGTCCGAACAGTAACTCTCTGGTAACTCTCTGTTTTCTCAGTGATTGTAGCCTGTAGTCATTAAACCTCTC

Full Affymetrix probeset data:

Annotations for 1628599_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime