FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628601_at:

>probe:Drosophila_2:1628601_at:101:175; Interrogation_Position=1453; Antisense; AAAGCCCAGACGCAAGAGCTGCTGC
>probe:Drosophila_2:1628601_at:301:419; Interrogation_Position=1468; Antisense; GAGCTGCTGCTAGAGCAATCCATTG
>probe:Drosophila_2:1628601_at:413:473; Interrogation_Position=1580; Antisense; GTTACTCCACGCTTCAAGATGCCAG
>probe:Drosophila_2:1628601_at:5:31; Interrogation_Position=1624; Antisense; ATACACCGGGTGATGCAGATGCTGA
>probe:Drosophila_2:1628601_at:182:555; Interrogation_Position=1724; Antisense; GGAGCCTATCCAGGGAATTGGCCTT
>probe:Drosophila_2:1628601_at:53:249; Interrogation_Position=1739; Antisense; AATTGGCCTTATGTGAGCTGGTATT
>probe:Drosophila_2:1628601_at:374:539; Interrogation_Position=1758; Antisense; GGTATTAAATTCCTATGTGCCCAAG
>probe:Drosophila_2:1628601_at:97:323; Interrogation_Position=1776; Antisense; GCCCAAGGAGTACCAATCGATGATT
>probe:Drosophila_2:1628601_at:24:75; Interrogation_Position=1876; Antisense; AGGAAACACATCTCGGCGCACAAGA
>probe:Drosophila_2:1628601_at:304:225; Interrogation_Position=1909; Antisense; AAGGAGCCAGATTTCCTCGATCTCT
>probe:Drosophila_2:1628601_at:121:637; Interrogation_Position=1925; Antisense; TCGATCTCTCACATGTCTATCTCAG
>probe:Drosophila_2:1628601_at:405:645; Interrogation_Position=1940; Antisense; TCTATCTCAGCTACAACACCGATGG
>probe:Drosophila_2:1628601_at:294:441; Interrogation_Position=1960; Antisense; GATGGCGTGTCCAATCCAATGCGCT
>probe:Drosophila_2:1628601_at:72:103; Interrogation_Position=2020; Antisense; AGACCGACGACTGCCAGGCGATATT

Paste this into a BLAST search page for me
AAAGCCCAGACGCAAGAGCTGCTGCGAGCTGCTGCTAGAGCAATCCATTGGTTACTCCACGCTTCAAGATGCCAGATACACCGGGTGATGCAGATGCTGAGGAGCCTATCCAGGGAATTGGCCTTAATTGGCCTTATGTGAGCTGGTATTGGTATTAAATTCCTATGTGCCCAAGGCCCAAGGAGTACCAATCGATGATTAGGAAACACATCTCGGCGCACAAGAAAGGAGCCAGATTTCCTCGATCTCTTCGATCTCTCACATGTCTATCTCAGTCTATCTCAGCTACAACACCGATGGGATGGCGTGTCCAATCCAATGCGCTAGACCGACGACTGCCAGGCGATATT

Full Affymetrix probeset data:

Annotations for 1628601_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720