FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628603_at:

>probe:Drosophila_2:1628603_at:300:717; Interrogation_Position=108; Antisense; TTCGTGTCGTCGTCGCGCAGGAAGA
>probe:Drosophila_2:1628603_at:512:375; Interrogation_Position=128; Antisense; GAAGAACCGCAAGCGTCACTTCCAG
>probe:Drosophila_2:1628603_at:447:373; Interrogation_Position=212; Antisense; GAAGTACAATGTGCGTTCCATGCCC
>probe:Drosophila_2:1628603_at:315:57; Interrogation_Position=250; Antisense; ATGAGGTCCAGGTGATCCGCGGCCA
>probe:Drosophila_2:1628603_at:172:591; Interrogation_Position=301; Antisense; TGGTCCAGGCCTACCGCAAAAAGTT
>probe:Drosophila_2:1628603_at:256:169; Interrogation_Position=320; Antisense; AAAGTTCGTCGTCTACGTCGAGAAG
>probe:Drosophila_2:1628603_at:199:215; Interrogation_Position=342; Antisense; AAGATCCAGCGCGAGAACGCCAACG
>probe:Drosophila_2:1628603_at:415:195; Interrogation_Position=363; Antisense; AACGGCACCAACGTCTACGTGGGCA
>probe:Drosophila_2:1628603_at:518:361; Interrogation_Position=397; Antisense; GCAAGGTGCTGATCGTCAAGCTGAA
>probe:Drosophila_2:1628603_at:350:251; Interrogation_Position=413; Antisense; CAAGCTGAAGCTCGACAAGGACCGC
>probe:Drosophila_2:1628603_at:455:655; Interrogation_Position=491; Antisense; TAAGGGCAAGTACACCGAGGAGACC
>probe:Drosophila_2:1628603_at:258:549; Interrogation_Position=530; Antisense; GGAGACCGCGTAAATCGCCGGCTAA
>probe:Drosophila_2:1628603_at:585:159; Interrogation_Position=568; Antisense; ACAACTGGGACGTCGCTGTTTACTG
>probe:Drosophila_2:1628603_at:650:387; Interrogation_Position=647; Antisense; GAAAACGGCGCCATTCTTTACAATA

Paste this into a BLAST search page for me
TTCGTGTCGTCGTCGCGCAGGAAGAGAAGAACCGCAAGCGTCACTTCCAGGAAGTACAATGTGCGTTCCATGCCCATGAGGTCCAGGTGATCCGCGGCCATGGTCCAGGCCTACCGCAAAAAGTTAAAGTTCGTCGTCTACGTCGAGAAGAAGATCCAGCGCGAGAACGCCAACGAACGGCACCAACGTCTACGTGGGCAGCAAGGTGCTGATCGTCAAGCTGAACAAGCTGAAGCTCGACAAGGACCGCTAAGGGCAAGTACACCGAGGAGACCGGAGACCGCGTAAATCGCCGGCTAAACAACTGGGACGTCGCTGTTTACTGGAAAACGGCGCCATTCTTTACAATA

Full Affymetrix probeset data:

Annotations for 1628603_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720