Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628604_at:

>probe:Drosophila_2:1628604_at:674:427; Interrogation_Position=2397; Antisense; GAGTACAATTGTTGACGCATTCCCA
>probe:Drosophila_2:1628604_at:434:611; Interrogation_Position=2409; Antisense; TGACGCATTCCCAAAGTGATCCACT
>probe:Drosophila_2:1628604_at:698:511; Interrogation_Position=2424; Antisense; GTGATCCACTGGTTTTAAATCTTCA
>probe:Drosophila_2:1628604_at:629:277; Interrogation_Position=2453; Antisense; CTCTAAGTAAGCCAATCCTCCAAAC
>probe:Drosophila_2:1628604_at:728:253; Interrogation_Position=2473; Antisense; CAAACCACTCCGCTTAATTCTAGTA
>probe:Drosophila_2:1628604_at:505:11; Interrogation_Position=2489; Antisense; ATTCTAGTACAATCTTCGCGCACTT
>probe:Drosophila_2:1628604_at:422:275; Interrogation_Position=2502; Antisense; CTTCGCGCACTTCAGATCTAGAGAG
>probe:Drosophila_2:1628604_at:655:697; Interrogation_Position=2585; Antisense; TTTAGCGCACTCACTATACCGCAAA
>probe:Drosophila_2:1628604_at:450:477; Interrogation_Position=2654; Antisense; GTTTTAAGCATCGAGCGAGCGCCTC
>probe:Drosophila_2:1628604_at:315:417; Interrogation_Position=2670; Antisense; GAGCGCCTCCTTCTTGTTGTTTTTT
>probe:Drosophila_2:1628604_at:307:693; Interrogation_Position=2694; Antisense; TTTCGCATCAGCACCTACCTAAAAT
>probe:Drosophila_2:1628604_at:210:247; Interrogation_Position=2734; Antisense; AATTGTCTAACCCTCTCAAATTGTA
>probe:Drosophila_2:1628604_at:604:489; Interrogation_Position=2756; Antisense; GTAAATATCCCTGCAACTATTCGTT
>probe:Drosophila_2:1628604_at:550:663; Interrogation_Position=2780; Antisense; TAAAGTCTCAGTGTAGCCCCAAATG

Paste this into a BLAST search page for me
GAGTACAATTGTTGACGCATTCCCATGACGCATTCCCAAAGTGATCCACTGTGATCCACTGGTTTTAAATCTTCACTCTAAGTAAGCCAATCCTCCAAACCAAACCACTCCGCTTAATTCTAGTAATTCTAGTACAATCTTCGCGCACTTCTTCGCGCACTTCAGATCTAGAGAGTTTAGCGCACTCACTATACCGCAAAGTTTTAAGCATCGAGCGAGCGCCTCGAGCGCCTCCTTCTTGTTGTTTTTTTTTCGCATCAGCACCTACCTAAAATAATTGTCTAACCCTCTCAAATTGTAGTAAATATCCCTGCAACTATTCGTTTAAAGTCTCAGTGTAGCCCCAAATG

Full Affymetrix probeset data:

Annotations for 1628604_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime