FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628605_at:

>probe:Drosophila_2:1628605_at:138:599; Interrogation_Position=417; Antisense; TGTCCGAGGATCAGCGCGATAACAT
>probe:Drosophila_2:1628605_at:443:661; Interrogation_Position=436; Antisense; TAACATCCGCTGTCTGGTTAGCTAT
>probe:Drosophila_2:1628605_at:285:63; Interrogation_Position=459; Antisense; ATGTGGAGAATGTCTTCACCCTGGC
>probe:Drosophila_2:1628605_at:124:711; Interrogation_Position=473; Antisense; TTCACCCTGGCGGAGATTCATATGA
>probe:Drosophila_2:1628605_at:253:33; Interrogation_Position=519; Antisense; ATCAACTTTACACGGCAACGCGCTG
>probe:Drosophila_2:1628605_at:3:649; Interrogation_Position=553; Antisense; TCATCCGTGGCCGTTGAGTACGATT
>probe:Drosophila_2:1628605_at:360:139; Interrogation_Position=572; Antisense; ACGATTCGCCGGTTTGCCAAGCAGA
>probe:Drosophila_2:1628605_at:477:643; Interrogation_Position=621; Antisense; TCTACCGGTGGCAGGATTTGGACAA
>probe:Drosophila_2:1628605_at:631:597; Interrogation_Position=674; Antisense; TGTGCCGATGCGTTGATCGCTGAAC
>probe:Drosophila_2:1628605_at:48:375; Interrogation_Position=715; Antisense; GAAGAGCTATTTCGGCGGCTCACGA
>probe:Drosophila_2:1628605_at:197:331; Interrogation_Position=729; Antisense; GCGGCTCACGACCTTGCAAATTGGA
>probe:Drosophila_2:1628605_at:35:25; Interrogation_Position=832; Antisense; ATATCCACGTCTATTGGCCCACTGT
>probe:Drosophila_2:1628605_at:113:319; Interrogation_Position=858; Antisense; GCCGCATCGATCAGAGCCTGTTTGA
>probe:Drosophila_2:1628605_at:175:481; Interrogation_Position=877; Antisense; GTTTGATGGCAAACTCCTGACCAGC

Paste this into a BLAST search page for me
TGTCCGAGGATCAGCGCGATAACATTAACATCCGCTGTCTGGTTAGCTATATGTGGAGAATGTCTTCACCCTGGCTTCACCCTGGCGGAGATTCATATGAATCAACTTTACACGGCAACGCGCTGTCATCCGTGGCCGTTGAGTACGATTACGATTCGCCGGTTTGCCAAGCAGATCTACCGGTGGCAGGATTTGGACAATGTGCCGATGCGTTGATCGCTGAACGAAGAGCTATTTCGGCGGCTCACGAGCGGCTCACGACCTTGCAAATTGGAATATCCACGTCTATTGGCCCACTGTGCCGCATCGATCAGAGCCTGTTTGAGTTTGATGGCAAACTCCTGACCAGC

Full Affymetrix probeset data:

Annotations for 1628605_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720