FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628608_at:

>probe:Drosophila_2:1628608_at:501:87; Interrogation_Position=436; Antisense; AGTCCCGACTACCACAATGATATTG
>probe:Drosophila_2:1628608_at:662:57; Interrogation_Position=494; Antisense; ATGAGTACACTCAACCGGCTGAGCT
>probe:Drosophila_2:1628608_at:296:169; Interrogation_Position=537; Antisense; AAATGGGACGCAGTTGCTCCTCACG
>probe:Drosophila_2:1628608_at:435:575; Interrogation_Position=586; Antisense; GGCGATACGCCCGATATACTGCAAA
>probe:Drosophila_2:1628608_at:149:185; Interrogation_Position=608; Antisense; AAAAGGCTTATCTCACGCATGTCGT
>probe:Drosophila_2:1628608_at:520:639; Interrogation_Position=629; Antisense; TCGTGTACTCGACTTGCCAGGAGAT
>probe:Drosophila_2:1628608_at:466:383; Interrogation_Position=672; Antisense; GAACGGTCCATGTCATATCTGCACA
>probe:Drosophila_2:1628608_at:2:41; Interrogation_Position=688; Antisense; ATCTGCACACTGACGACTGGTGGAC
>probe:Drosophila_2:1628608_at:474:559; Interrogation_Position=709; Antisense; GGACAAGGAGCCTGCCATGGCGATT
>probe:Drosophila_2:1628608_at:339:335; Interrogation_Position=744; Antisense; GCTGACGCACAACGGAGTACTCTAC
>probe:Drosophila_2:1628608_at:458:89; Interrogation_Position=759; Antisense; AGTACTCTACGGTCTGGTCAATTGG
>probe:Drosophila_2:1628608_at:266:507; Interrogation_Position=794; Antisense; GTGCACTTGGAGTTCCCGATAGTCA
>probe:Drosophila_2:1628608_at:43:453; Interrogation_Position=858; Antisense; GATCTCGGGACCATGTAGCAACTGT
>probe:Drosophila_2:1628608_at:582:359; Interrogation_Position=875; Antisense; GCAACTGTCACTGCTATGCCAGTAA

Paste this into a BLAST search page for me
AGTCCCGACTACCACAATGATATTGATGAGTACACTCAACCGGCTGAGCTAAATGGGACGCAGTTGCTCCTCACGGGCGATACGCCCGATATACTGCAAAAAAAGGCTTATCTCACGCATGTCGTTCGTGTACTCGACTTGCCAGGAGATGAACGGTCCATGTCATATCTGCACAATCTGCACACTGACGACTGGTGGACGGACAAGGAGCCTGCCATGGCGATTGCTGACGCACAACGGAGTACTCTACAGTACTCTACGGTCTGGTCAATTGGGTGCACTTGGAGTTCCCGATAGTCAGATCTCGGGACCATGTAGCAACTGTGCAACTGTCACTGCTATGCCAGTAA

Full Affymetrix probeset data:

Annotations for 1628608_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720