FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628609_at:

>probe:Drosophila_2:1628609_at:564:95; Interrogation_Position=242; Antisense; AGATTAGTGGCGGTCTGTTCGCACC
>probe:Drosophila_2:1628609_at:238:261; Interrogation_Position=306; Antisense; CACCTCGATTCCGATGGCAGTGGAT
>probe:Drosophila_2:1628609_at:387:267; Interrogation_Position=323; Antisense; CAGTGGATGGCGAGGTGCACCACCT
>probe:Drosophila_2:1628609_at:121:47; Interrogation_Position=353; Antisense; ATCCGCGTCGCAGTTGGCAGCGGAA
>probe:Drosophila_2:1628609_at:59:139; Interrogation_Position=467; Antisense; ACGATGATGAGTTCGGTGCTTCCGT
>probe:Drosophila_2:1628609_at:462:507; Interrogation_Position=482; Antisense; GTGCTTCCGTTTGCGAGGATAACCC
>probe:Drosophila_2:1628609_at:374:453; Interrogation_Position=499; Antisense; GATAACCCGGAGGAGGCCATTGCAC
>probe:Drosophila_2:1628609_at:566:77; Interrogation_Position=509; Antisense; AGGAGGCCATTGCACGCGCTGACCA
>probe:Drosophila_2:1628609_at:443:353; Interrogation_Position=552; Antisense; GCACTATCAGCCAAATGCCAGCGAT
>probe:Drosophila_2:1628609_at:263:313; Interrogation_Position=568; Antisense; GCCAGCGATTCCAGTTATGTGGAAA
>probe:Drosophila_2:1628609_at:97:269; Interrogation_Position=597; Antisense; CAGGAAGCTGATACAGTGGCGCTAC
>probe:Drosophila_2:1628609_at:113:83; Interrogation_Position=611; Antisense; AGTGGCGCTACTGCAAATCAATTTG
>probe:Drosophila_2:1628609_at:729:163; Interrogation_Position=625; Antisense; AAATCAATTTGCCTGCGCGGCCAAC
>probe:Drosophila_2:1628609_at:122:179; Interrogation_Position=99; Antisense; AAAATATGGCTACAACCTCTCCAAC

Paste this into a BLAST search page for me
AGATTAGTGGCGGTCTGTTCGCACCCACCTCGATTCCGATGGCAGTGGATCAGTGGATGGCGAGGTGCACCACCTATCCGCGTCGCAGTTGGCAGCGGAAACGATGATGAGTTCGGTGCTTCCGTGTGCTTCCGTTTGCGAGGATAACCCGATAACCCGGAGGAGGCCATTGCACAGGAGGCCATTGCACGCGCTGACCAGCACTATCAGCCAAATGCCAGCGATGCCAGCGATTCCAGTTATGTGGAAACAGGAAGCTGATACAGTGGCGCTACAGTGGCGCTACTGCAAATCAATTTGAAATCAATTTGCCTGCGCGGCCAACAAAATATGGCTACAACCTCTCCAAC

Full Affymetrix probeset data:

Annotations for 1628609_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720