FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628610_at:

>probe:Drosophila_2:1628610_at:650:61; Interrogation_Position=157; Antisense; ATGTCGGGCACATCGCAGAAACACA
>probe:Drosophila_2:1628610_at:27:155; Interrogation_Position=179; Antisense; ACAGGAACTTCGTTGCGGAGCCAAT
>probe:Drosophila_2:1628610_at:275:561; Interrogation_Position=240; Antisense; GGAAACCCTCGGTGGACGCTTGAAG
>probe:Drosophila_2:1628610_at:561:21; Interrogation_Position=278; Antisense; ATATGGCCTACACCGTTTTGGGACA
>probe:Drosophila_2:1628610_at:254:55; Interrogation_Position=346; Antisense; ATGAAGGAGGTGTGCCACGCCAGCT
>probe:Drosophila_2:1628610_at:557:69; Interrogation_Position=377; Antisense; AGGCATCCGATTGCTACAACTGTCT
>probe:Drosophila_2:1628610_at:643:159; Interrogation_Position=392; Antisense; ACAACTGTCTCAACGATTGGTGCGA
>probe:Drosophila_2:1628610_at:184:521; Interrogation_Position=433; Antisense; GTGGACACACAAGCCATCCGAGTAA
>probe:Drosophila_2:1628610_at:642:569; Interrogation_Position=482; Antisense; GGCATCGGCCAATCATTTTTATTCG
>probe:Drosophila_2:1628610_at:513:393; Interrogation_Position=515; Antisense; GAAAGTGGCCCAATGCTAGCTAAGC
>probe:Drosophila_2:1628610_at:607:345; Interrogation_Position=538; Antisense; GCATTTGCCGTGTTCACTGTTAGTA
>probe:Drosophila_2:1628610_at:160:143; Interrogation_Position=54; Antisense; ACTGGCTGTGCGTCATTTTCAGAAA
>probe:Drosophila_2:1628610_at:527:345; Interrogation_Position=628; Antisense; GCATTTGGATCTCTGTTCTGCGAAA
>probe:Drosophila_2:1628610_at:370:391; Interrogation_Position=75; Antisense; GAAACGCCGCGAATATTTTGCCATT

Paste this into a BLAST search page for me
ATGTCGGGCACATCGCAGAAACACAACAGGAACTTCGTTGCGGAGCCAATGGAAACCCTCGGTGGACGCTTGAAGATATGGCCTACACCGTTTTGGGACAATGAAGGAGGTGTGCCACGCCAGCTAGGCATCCGATTGCTACAACTGTCTACAACTGTCTCAACGATTGGTGCGAGTGGACACACAAGCCATCCGAGTAAGGCATCGGCCAATCATTTTTATTCGGAAAGTGGCCCAATGCTAGCTAAGCGCATTTGCCGTGTTCACTGTTAGTAACTGGCTGTGCGTCATTTTCAGAAAGCATTTGGATCTCTGTTCTGCGAAAGAAACGCCGCGAATATTTTGCCATT

Full Affymetrix probeset data:

Annotations for 1628610_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720