FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628611_at:

>probe:Drosophila_2:1628611_at:374:345; Interrogation_Position=1317; Antisense; GCATTGCCGTGCTGGACGTGATCGA
>probe:Drosophila_2:1628611_at:9:615; Interrogation_Position=1353; Antisense; TGCAGCGCAACTCCCTTGAAGTGGG
>probe:Drosophila_2:1628611_at:436:613; Interrogation_Position=1369; Antisense; TGAAGTGGGCACGTACTTCCTCAAA
>probe:Drosophila_2:1628611_at:690:489; Interrogation_Position=1381; Antisense; GTACTTCCTCAAAGGTCTGGCTGAA
>probe:Drosophila_2:1628611_at:241:615; Interrogation_Position=1402; Antisense; TGAATTGCAGCAGCGCTTCGAGATT
>probe:Drosophila_2:1628611_at:532:227; Interrogation_Position=1446; Antisense; AAGGCCTGATGATCGGCGTCGAGCT
>probe:Drosophila_2:1628611_at:7:565; Interrogation_Position=1475; Antisense; GGCAATCGTGAAAAGCGTACCCCTC
>probe:Drosophila_2:1628611_at:614:309; Interrogation_Position=1510; Antisense; CCACGTCCTGGACATCTGGGAGAAG
>probe:Drosophila_2:1628611_at:270:585; Interrogation_Position=1558; Antisense; TGGACGCGGCGGTCTTCATGGAAAC
>probe:Drosophila_2:1628611_at:362:585; Interrogation_Position=1576; Antisense; TGGAAACGTTCTGCGCATTAAGCCT
>probe:Drosophila_2:1628611_at:712:333; Interrogation_Position=1619; Antisense; GCTGATGCCAAGTTCGCCGTGGATG
>probe:Drosophila_2:1628611_at:429:271; Interrogation_Position=1657; Antisense; CATCACGGAGACTCTACCCGAGAAT
>probe:Drosophila_2:1628611_at:239:547; Interrogation_Position=1734; Antisense; GGATGGTCTCAGCTGCATTTATTAA
>probe:Drosophila_2:1628611_at:498:57; Interrogation_Position=1811; Antisense; ATGGACCTCTAAATCGTCAACTGTT

Paste this into a BLAST search page for me
GCATTGCCGTGCTGGACGTGATCGATGCAGCGCAACTCCCTTGAAGTGGGTGAAGTGGGCACGTACTTCCTCAAAGTACTTCCTCAAAGGTCTGGCTGAATGAATTGCAGCAGCGCTTCGAGATTAAGGCCTGATGATCGGCGTCGAGCTGGCAATCGTGAAAAGCGTACCCCTCCCACGTCCTGGACATCTGGGAGAAGTGGACGCGGCGGTCTTCATGGAAACTGGAAACGTTCTGCGCATTAAGCCTGCTGATGCCAAGTTCGCCGTGGATGCATCACGGAGACTCTACCCGAGAATGGATGGTCTCAGCTGCATTTATTAAATGGACCTCTAAATCGTCAACTGTT

Full Affymetrix probeset data:

Annotations for 1628611_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720