FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628612_at:

>probe:Drosophila_2:1628612_at:609:385; Interrogation_Position=1437; Antisense; GAACATCAATGTCCGAGCTGCTATC
>probe:Drosophila_2:1628612_at:71:419; Interrogation_Position=1451; Antisense; GAGCTGCTATCATCCACGTGGTTGG
>probe:Drosophila_2:1628612_at:389:469; Interrogation_Position=1504; Antisense; GTTGCCGCCCTGATAATATTCTTTT
>probe:Drosophila_2:1628612_at:25:579; Interrogation_Position=1539; Antisense; GGCCTTCATGGATTCGGTTTGCACA
>probe:Drosophila_2:1628612_at:483:149; Interrogation_Position=1561; Antisense; ACATTTGTCTTTTCAGTGCTGGTTC
>probe:Drosophila_2:1628612_at:143:621; Interrogation_Position=1577; Antisense; TGCTGGTTCTTGTCGTTACGTTCAA
>probe:Drosophila_2:1628612_at:376:653; Interrogation_Position=1607; Antisense; TAAGGGACGTCCTCATGGTTCTGAT
>probe:Drosophila_2:1628612_at:410:1; Interrogation_Position=1634; Antisense; AGGCCACGCCCGATTTTATGGATTA
>probe:Drosophila_2:1628612_at:424:401; Interrogation_Position=1674; Antisense; GACATTTTTGTCCATTTCGGGTGTG
>probe:Drosophila_2:1628612_at:552:435; Interrogation_Position=1716; Antisense; GAGGATATGGGCTCTGTCCATCAAT
>probe:Drosophila_2:1628612_at:574:239; Interrogation_Position=1738; Antisense; AATAAGGTGGCTTTATCCGCTCATT
>probe:Drosophila_2:1628612_at:539:449; Interrogation_Position=1783; Antisense; GATCCCCAGCTGATTCTCGAGGAGG
>probe:Drosophila_2:1628612_at:157:259; Interrogation_Position=1812; Antisense; CACTCTGATTCACAAGCGCTTCAAA
>probe:Drosophila_2:1628612_at:642:565; Interrogation_Position=1892; Antisense; GGCAATGTTTGAGCCCTTCGGATAA

Paste this into a BLAST search page for me
GAACATCAATGTCCGAGCTGCTATCGAGCTGCTATCATCCACGTGGTTGGGTTGCCGCCCTGATAATATTCTTTTGGCCTTCATGGATTCGGTTTGCACAACATTTGTCTTTTCAGTGCTGGTTCTGCTGGTTCTTGTCGTTACGTTCAATAAGGGACGTCCTCATGGTTCTGATAGGCCACGCCCGATTTTATGGATTAGACATTTTTGTCCATTTCGGGTGTGGAGGATATGGGCTCTGTCCATCAATAATAAGGTGGCTTTATCCGCTCATTGATCCCCAGCTGATTCTCGAGGAGGCACTCTGATTCACAAGCGCTTCAAAGGCAATGTTTGAGCCCTTCGGATAA

Full Affymetrix probeset data:

Annotations for 1628612_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720