FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628614_at:

>probe:Drosophila_2:1628614_at:420:573; Interrogation_Position=1049; Antisense; GGCTGGAGGCCATGTTCATACACGA
>probe:Drosophila_2:1628614_at:243:665; Interrogation_Position=1067; Antisense; TACACGAACAAGTGCGACGGGCCGT
>probe:Drosophila_2:1628614_at:557:107; Interrogation_Position=1094; Antisense; AGAACCACCAGCTCATTCTGGAGGA
>probe:Drosophila_2:1628614_at:480:549; Interrogation_Position=1113; Antisense; GGAGGAGTCGGTGCGATCCATCTAC
>probe:Drosophila_2:1628614_at:98:37; Interrogation_Position=1132; Antisense; ATCTACTATGCCAAGGAGCTCTTCC
>probe:Drosophila_2:1628614_at:62:719; Interrogation_Position=1153; Antisense; TTCCGCCTTATCGAGGATCACGAGG
>probe:Drosophila_2:1628614_at:605:407; Interrogation_Position=1217; Antisense; GACGGACCCTTCTTGAATGGCATAG
>probe:Drosophila_2:1628614_at:74:427; Interrogation_Position=817; Antisense; GAGATGATCCGTGAGCACTTGGCAC
>probe:Drosophila_2:1628614_at:337:137; Interrogation_Position=840; Antisense; ACGAGAAATGGTCTGCACTCCGGCC
>probe:Drosophila_2:1628614_at:41:55; Interrogation_Position=867; Antisense; ATGCAGAACGGTAATCAGCGCCTCC
>probe:Drosophila_2:1628614_at:218:317; Interrogation_Position=886; Antisense; GCCTCCGACGGAATCTTCAATGTGA
>probe:Drosophila_2:1628614_at:384:711; Interrogation_Position=901; Antisense; TTCAATGTGAATGCCGGTGTCATCG
>probe:Drosophila_2:1628614_at:472:515; Interrogation_Position=917; Antisense; GTGTCATCGGCGACATCTGTAGCTA
>probe:Drosophila_2:1628614_at:235:325; Interrogation_Position=995; Antisense; GCGAAGCACGTCTCCGGAACAACGA

Paste this into a BLAST search page for me
GGCTGGAGGCCATGTTCATACACGATACACGAACAAGTGCGACGGGCCGTAGAACCACCAGCTCATTCTGGAGGAGGAGGAGTCGGTGCGATCCATCTACATCTACTATGCCAAGGAGCTCTTCCTTCCGCCTTATCGAGGATCACGAGGGACGGACCCTTCTTGAATGGCATAGGAGATGATCCGTGAGCACTTGGCACACGAGAAATGGTCTGCACTCCGGCCATGCAGAACGGTAATCAGCGCCTCCGCCTCCGACGGAATCTTCAATGTGATTCAATGTGAATGCCGGTGTCATCGGTGTCATCGGCGACATCTGTAGCTAGCGAAGCACGTCTCCGGAACAACGA

Full Affymetrix probeset data:

Annotations for 1628614_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720