FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628615_at:

>probe:Drosophila_2:1628615_at:45:387; Interrogation_Position=424; Antisense; GAAAACGAACTCACGCGCAAAAGGT
>probe:Drosophila_2:1628615_at:276:101; Interrogation_Position=522; Antisense; AGAGGGTCGGCCCACTGAGCCAATA
>probe:Drosophila_2:1628615_at:392:143; Interrogation_Position=535; Antisense; ACTGAGCCAATACCCGAGGACGATC
>probe:Drosophila_2:1628615_at:648:437; Interrogation_Position=550; Antisense; GAGGACGATCCCACCAAGTACAAGC
>probe:Drosophila_2:1628615_at:83:491; Interrogation_Position=567; Antisense; GTACAAGCACGCCATCTACGTTATG
>probe:Drosophila_2:1628615_at:325:177; Interrogation_Position=598; Antisense; AAACTGTTTGCCGACATGGAGCGTC
>probe:Drosophila_2:1628615_at:497:405; Interrogation_Position=623; Antisense; GACGGCAAAAGCTCGACCAACGCGA
>probe:Drosophila_2:1628615_at:525:289; Interrogation_Position=707; Antisense; CGGACCGCGAATGGCAGCAGAACTT
>probe:Drosophila_2:1628615_at:660:213; Interrogation_Position=734; Antisense; AAGAGTCGCGCCAGAGCCGAGTAAA
>probe:Drosophila_2:1628615_at:702:187; Interrogation_Position=757; Antisense; AACAGCTGGCATGACTTTCAGTCGG
>probe:Drosophila_2:1628615_at:191:57; Interrogation_Position=820; Antisense; ATGACCGGCATGATGGTTCCACCAA
>probe:Drosophila_2:1628615_at:469:163; Interrogation_Position=844; Antisense; AAATTTAAGCCCGAGTCGCGATAAT
>probe:Drosophila_2:1628615_at:316:455; Interrogation_Position=863; Antisense; GATAATATAGCTTCCCAGCGCGGCG
>probe:Drosophila_2:1628615_at:227:329; Interrogation_Position=926; Antisense; GCGTCGCGTTGCACATGAATATTTT

Paste this into a BLAST search page for me
GAAAACGAACTCACGCGCAAAAGGTAGAGGGTCGGCCCACTGAGCCAATAACTGAGCCAATACCCGAGGACGATCGAGGACGATCCCACCAAGTACAAGCGTACAAGCACGCCATCTACGTTATGAAACTGTTTGCCGACATGGAGCGTCGACGGCAAAAGCTCGACCAACGCGACGGACCGCGAATGGCAGCAGAACTTAAGAGTCGCGCCAGAGCCGAGTAAAAACAGCTGGCATGACTTTCAGTCGGATGACCGGCATGATGGTTCCACCAAAAATTTAAGCCCGAGTCGCGATAATGATAATATAGCTTCCCAGCGCGGCGGCGTCGCGTTGCACATGAATATTTT

Full Affymetrix probeset data:

Annotations for 1628615_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720