FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628616_at:

>probe:Drosophila_2:1628616_at:502:179; Interrogation_Position=2187; Antisense; AAAAATCCGTGCTCCGTCGACAAAG
>probe:Drosophila_2:1628616_at:532:327; Interrogation_Position=2219; Antisense; GCGATATCCCTCTATATGGCATCAT
>probe:Drosophila_2:1628616_at:458:485; Interrogation_Position=2254; Antisense; GTAGTGGAGCCTAGTCTATGCACCC
>probe:Drosophila_2:1628616_at:467:593; Interrogation_Position=2284; Antisense; TGGGAGGGATTTTCACAGCTGCGCC
>probe:Drosophila_2:1628616_at:569:545; Interrogation_Position=2322; Antisense; GGATCTTCTGCTTCACTCTAGAGAT
>probe:Drosophila_2:1628616_at:416:1; Interrogation_Position=2412; Antisense; CAGTTCCAAGTTTCTACCCGTTGAG
>probe:Drosophila_2:1628616_at:355:513; Interrogation_Position=2450; Antisense; GTGATGGCACCTACAACATATCCTT
>probe:Drosophila_2:1628616_at:720:81; Interrogation_Position=2489; Antisense; AGGGCACGTTGATTCTCACGATCAC
>probe:Drosophila_2:1628616_at:679:649; Interrogation_Position=2517; Antisense; TAACGACCGGCCCATCAAGGGAGGT
>probe:Drosophila_2:1628616_at:102:81; Interrogation_Position=2538; Antisense; AGGTCCTTTCACTTTTCAAGCGCGA
>probe:Drosophila_2:1628616_at:256:337; Interrogation_Position=2597; Antisense; GCTCCTTCTGTTCCGGAAAGGGCAA
>probe:Drosophila_2:1628616_at:347:679; Interrogation_Position=2664; Antisense; TAGTGGCTGCGGTCATGGACATGCT
>probe:Drosophila_2:1628616_at:400:105; Interrogation_Position=2701; Antisense; AGACGTCATTGGTCCTGCTGTGGAA
>probe:Drosophila_2:1628616_at:195:523; Interrogation_Position=2752; Antisense; GTGGCCAACAAACTGCTTAATTCTT

Paste this into a BLAST search page for me
AAAAATCCGTGCTCCGTCGACAAAGGCGATATCCCTCTATATGGCATCATGTAGTGGAGCCTAGTCTATGCACCCTGGGAGGGATTTTCACAGCTGCGCCGGATCTTCTGCTTCACTCTAGAGATCAGTTCCAAGTTTCTACCCGTTGAGGTGATGGCACCTACAACATATCCTTAGGGCACGTTGATTCTCACGATCACTAACGACCGGCCCATCAAGGGAGGTAGGTCCTTTCACTTTTCAAGCGCGAGCTCCTTCTGTTCCGGAAAGGGCAATAGTGGCTGCGGTCATGGACATGCTAGACGTCATTGGTCCTGCTGTGGAAGTGGCCAACAAACTGCTTAATTCTT

Full Affymetrix probeset data:

Annotations for 1628616_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720