Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

 University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628617_at:

>probe:Drosophila_2:1628617_at:602:39; Interrogation_Position=102; Antisense; ATCTGGAAGATTCAGTGGTCCTTGC
>probe:Drosophila_2:1628617_at:90:217; Interrogation_Position=108; Antisense; AAGATTCAGTGGTCCTTGCTGGGCC
>probe:Drosophila_2:1628617_at:470:307; Interrogation_Position=121; Antisense; CCTTGCTGGGCCTGGGATGGAGAGC
>probe:Drosophila_2:1628617_at:609:101; Interrogation_Position=141; Antisense; AGAGCAGTGCCGTCGCCTCTGCAGG
>probe:Drosophila_2:1628617_at:498:709; Interrogation_Position=23; Antisense; TTAAAGGATTGTTTGCTCTCCTCGC
>probe:Drosophila_2:1628617_at:24:171; Interrogation_Position=25; Antisense; AAAGGATTGTTTGCTCTCCTCGCTG
>probe:Drosophila_2:1628617_at:51:727; Interrogation_Position=31; Antisense; TTGTTTGCTCTCCTCGCTGTGGTGA
>probe:Drosophila_2:1628617_at:102:283; Interrogation_Position=43; Antisense; CTCGCTGTGGTGACCATTGTCCTAA
>probe:Drosophila_2:1628617_at:519:5; Interrogation_Position=58; Antisense; ATTGTCCTAATGGTGGCCAACTCGG
>probe:Drosophila_2:1628617_at:339:655; Interrogation_Position=65; Antisense; TAATGGTGGCCAACTCGGCTTCGGC
>probe:Drosophila_2:1628617_at:267:579; Interrogation_Position=72; Antisense; GGCCAACTCGGCTTCGGCCGTGGAT
>probe:Drosophila_2:1628617_at:145:639; Interrogation_Position=85; Antisense; TCGGCCGTGGATTGCCCATCTGGAA
>probe:Drosophila_2:1628617_at:87:305; Interrogation_Position=89; Antisense; CCGTGGATTGCCCATCTGGAAGATT
>probe:Drosophila_2:1628617_at:115:543; Interrogation_Position=93; Antisense; GGATTGCCCATCTGGAAGATTCAGT

Paste this into a BLAST search page for me
ATCTGGAAGATTCAGTGGTCCTTGCAAGATTCAGTGGTCCTTGCTGGGCCCCTTGCTGGGCCTGGGATGGAGAGCAGAGCAGTGCCGTCGCCTCTGCAGGTTAAAGGATTGTTTGCTCTCCTCGCAAAGGATTGTTTGCTCTCCTCGCTGTTGTTTGCTCTCCTCGCTGTGGTGACTCGCTGTGGTGACCATTGTCCTAAATTGTCCTAATGGTGGCCAACTCGGTAATGGTGGCCAACTCGGCTTCGGCGGCCAACTCGGCTTCGGCCGTGGATTCGGCCGTGGATTGCCCATCTGGAACCGTGGATTGCCCATCTGGAAGATTGGATTGCCCATCTGGAAGATTCAGT

Full Affymetrix probeset data:

Annotations for 1628617_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime