Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

 University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628618_at:

>probe:Drosophila_2:1628618_at:443:123; Interrogation_Position=457; Antisense; AGCGCTTGTCGAAACACTGGCGAAC
>probe:Drosophila_2:1628618_at:144:175; Interrogation_Position=522; Antisense; AAAGCCGATCAGTTCATTTGCAAGC
>probe:Drosophila_2:1628618_at:133:19; Interrogation_Position=537; Antisense; ATTTGCAAGCGTATCGTGGCCGTTT
>probe:Drosophila_2:1628618_at:345:317; Interrogation_Position=555; Antisense; GCCGTTTCCGGTGATCAGGTGCTAA
>probe:Drosophila_2:1628618_at:605:647; Interrogation_Position=569; Antisense; TCAGGTGCTAATCCAGAAGCCCATT
>probe:Drosophila_2:1628618_at:199:379; Interrogation_Position=584; Antisense; GAAGCCCATTCCCATTGAGGCGGAG
>probe:Drosophila_2:1628618_at:316:107; Interrogation_Position=634; Antisense; AGAAGCCCGTGATGGTCAAGGACTA
>probe:Drosophila_2:1628618_at:443:653; Interrogation_Position=649; Antisense; TCAAGGACTATGTGCCGCGCGGACA
>probe:Drosophila_2:1628618_at:106:625; Interrogation_Position=661; Antisense; TGCCGCGCGGACACGTTTGGATTGA
>probe:Drosophila_2:1628618_at:686:81; Interrogation_Position=697; Antisense; AGGGAAACAGCTCGGATTCCCGCTA
>probe:Drosophila_2:1628618_at:199:23; Interrogation_Position=780; Antisense; ATATCCGAGGCCACGGGTCTATAGA
>probe:Drosophila_2:1628618_at:498:663; Interrogation_Position=847; Antisense; TAAATGGCCTATGTTTCGTTTGGAA
>probe:Drosophila_2:1628618_at:686:429; Interrogation_Position=917; Antisense; GAGTTTCGTCTCATTTGTGCGACTT
>probe:Drosophila_2:1628618_at:207:325; Interrogation_Position=935; Antisense; GCGACTTCTGGTTTTTGCATATCAT

Paste this into a BLAST search page for me
AGCGCTTGTCGAAACACTGGCGAACAAAGCCGATCAGTTCATTTGCAAGCATTTGCAAGCGTATCGTGGCCGTTTGCCGTTTCCGGTGATCAGGTGCTAATCAGGTGCTAATCCAGAAGCCCATTGAAGCCCATTCCCATTGAGGCGGAGAGAAGCCCGTGATGGTCAAGGACTATCAAGGACTATGTGCCGCGCGGACATGCCGCGCGGACACGTTTGGATTGAAGGGAAACAGCTCGGATTCCCGCTAATATCCGAGGCCACGGGTCTATAGATAAATGGCCTATGTTTCGTTTGGAAGAGTTTCGTCTCATTTGTGCGACTTGCGACTTCTGGTTTTTGCATATCAT

Full Affymetrix probeset data:

Annotations for 1628618_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime