Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628620_at:

>probe:Drosophila_2:1628620_at:559:29; Interrogation_Position=219; Antisense; ATACTTTTCAATTACCATCGGGCAC
>probe:Drosophila_2:1628620_at:649:129; Interrogation_Position=232; Antisense; ACCATCGGGCACAGATAGCGTCTAT
>probe:Drosophila_2:1628620_at:477:311; Interrogation_Position=260; Antisense; GCCAACCCTTCGATGAACGAGCTAA
>probe:Drosophila_2:1628620_at:405:117; Interrogation_Position=289; Antisense; AGCTATTCAAAGTGGCTCCTCAATG
>probe:Drosophila_2:1628620_at:645:521; Interrogation_Position=300; Antisense; GTGGCTCCTCAATGGACACATTTAA
>probe:Drosophila_2:1628620_at:719:147; Interrogation_Position=317; Antisense; ACATTTAAGCGCGTCATAGTATCAA
>probe:Drosophila_2:1628620_at:98:59; Interrogation_Position=341; Antisense; ATGATTGTCCCAATTCCCAGAACTT
>probe:Drosophila_2:1628620_at:636:323; Interrogation_Position=383; Antisense; GCGAACTCTCCTTGCTATCAAAATT
>probe:Drosophila_2:1628620_at:477:401; Interrogation_Position=411; Antisense; GACTTACCCCAAATGTAGTGCACCG
>probe:Drosophila_2:1628620_at:210:601; Interrogation_Position=424; Antisense; TGTAGTGCACCGAAGTCATTCTTTC
>probe:Drosophila_2:1628620_at:335:219; Interrogation_Position=436; Antisense; AAGTCATTCTTTCGATCAGCCGCAA
>probe:Drosophila_2:1628620_at:498:647; Interrogation_Position=451; Antisense; TCAGCCGCAAGTGGGAATGTCAGTT
>probe:Drosophila_2:1628620_at:301:231; Interrogation_Position=466; Antisense; AATGTCAGTTCAACGACTGCCGAGA
>probe:Drosophila_2:1628620_at:517:325; Interrogation_Position=504; Antisense; GCGATTTGTTGCAGCCCAGGAGGTC

Paste this into a BLAST search page for me
ATACTTTTCAATTACCATCGGGCACACCATCGGGCACAGATAGCGTCTATGCCAACCCTTCGATGAACGAGCTAAAGCTATTCAAAGTGGCTCCTCAATGGTGGCTCCTCAATGGACACATTTAAACATTTAAGCGCGTCATAGTATCAAATGATTGTCCCAATTCCCAGAACTTGCGAACTCTCCTTGCTATCAAAATTGACTTACCCCAAATGTAGTGCACCGTGTAGTGCACCGAAGTCATTCTTTCAAGTCATTCTTTCGATCAGCCGCAATCAGCCGCAAGTGGGAATGTCAGTTAATGTCAGTTCAACGACTGCCGAGAGCGATTTGTTGCAGCCCAGGAGGTC

Full Affymetrix probeset data:

Annotations for 1628620_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime