Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628622_s_at:

>probe:Drosophila_2:1628622_s_at:685:265; Interrogation_Position=115; Antisense; CAGTTGCCGTCAATTATCGCTCAAT
>probe:Drosophila_2:1628622_s_at:45:685; Interrogation_Position=129; Antisense; TATCGCTCAATATATTCTCCGTTGG
>probe:Drosophila_2:1628622_s_at:415:21; Interrogation_Position=140; Antisense; ATATTCTCCGTTGGCCTGTGATAAA
>probe:Drosophila_2:1628622_s_at:69:573; Interrogation_Position=17; Antisense; GGCTGCCAGGGCAAAATCTGCTAGC
>probe:Drosophila_2:1628622_s_at:729:651; Interrogation_Position=179; Antisense; TAATGAACGACCTTCGGTCCAAGTC
>probe:Drosophila_2:1628622_s_at:728:535; Interrogation_Position=194; Antisense; GGTCCAAGTCATTCTATCGTGCAGG
>probe:Drosophila_2:1628622_s_at:123:685; Interrogation_Position=208; Antisense; TATCGTGCAGGCAAACCAACATCTG
>probe:Drosophila_2:1628622_s_at:425:217; Interrogation_Position=265; Antisense; AAGTCGTTCGACAAGGGCCAGAACA
>probe:Drosophila_2:1628622_s_at:378:263; Interrogation_Position=312; Antisense; CAGCGGCAAGTCGAACAAGGTGTTC
>probe:Drosophila_2:1628622_s_at:129:251; Interrogation_Position=327; Antisense; CAAGGTGTTCCTGCATTACATACCC
>probe:Drosophila_2:1628622_s_at:565:619; Interrogation_Position=35; Antisense; TGCTAGCCGGCAGCACAAACTGCAA
>probe:Drosophila_2:1628622_s_at:578:325; Interrogation_Position=353; Antisense; GCGATCCGCGCCTAAGAATTTTCAA
>probe:Drosophila_2:1628622_s_at:119:365; Interrogation_Position=393; Antisense; GAATAAACACTCGAATCGCACCCTG
>probe:Drosophila_2:1628622_s_at:577:247; Interrogation_Position=458; Antisense; AATTGATTGGCGGTGGTGCCGAAAC

Paste this into a BLAST search page for me
CAGTTGCCGTCAATTATCGCTCAATTATCGCTCAATATATTCTCCGTTGGATATTCTCCGTTGGCCTGTGATAAAGGCTGCCAGGGCAAAATCTGCTAGCTAATGAACGACCTTCGGTCCAAGTCGGTCCAAGTCATTCTATCGTGCAGGTATCGTGCAGGCAAACCAACATCTGAAGTCGTTCGACAAGGGCCAGAACACAGCGGCAAGTCGAACAAGGTGTTCCAAGGTGTTCCTGCATTACATACCCTGCTAGCCGGCAGCACAAACTGCAAGCGATCCGCGCCTAAGAATTTTCAAGAATAAACACTCGAATCGCACCCTGAATTGATTGGCGGTGGTGCCGAAAC

Full Affymetrix probeset data:

Annotations for 1628622_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime