FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628623_at:

>probe:Drosophila_2:1628623_at:648:407; Interrogation_Position=1462; Antisense; GACGACCTGGTTGCCTACAGTGATA
>probe:Drosophila_2:1628623_at:275:49; Interrogation_Position=1532; Antisense; ATGCCGACGACTTGGTGCTGGTCAA
>probe:Drosophila_2:1628623_at:170:395; Interrogation_Position=1557; Antisense; GAAATCCCGCAGTGGCAAGCGCGAA
>probe:Drosophila_2:1628623_at:387:335; Interrogation_Position=1593; Antisense; GCTGCGTAAGCGTCCCACAAAGAAG
>probe:Drosophila_2:1628623_at:280:213; Interrogation_Position=1615; Antisense; AAGACCACCGCGGACCATTGAAAAG
>probe:Drosophila_2:1628623_at:605:433; Interrogation_Position=1681; Antisense; GAGGGACCACCATTAACCACCGAAG
>probe:Drosophila_2:1628623_at:560:507; Interrogation_Position=1721; Antisense; GTGCGACGCTTGAGCCAAAGACTAA
>probe:Drosophila_2:1628623_at:169:157; Interrogation_Position=1772; Antisense; ACAGCCAGCTGAAGTATTCCGGCGG
>probe:Drosophila_2:1628623_at:217:9; Interrogation_Position=1787; Antisense; ATTCCGGCGGATTAGCTTCAAGCTT
>probe:Drosophila_2:1628623_at:632:197; Interrogation_Position=1806; Antisense; AAGCTTCAACTGGTTCTTACTTAAG
>probe:Drosophila_2:1628623_at:52:465; Interrogation_Position=1883; Antisense; GATTGCCTTGTAGATTGCTGAACTT
>probe:Drosophila_2:1628623_at:138:351; Interrogation_Position=1920; Antisense; GCAGTTGCTCATTCGTTGTTATCTA
>probe:Drosophila_2:1628623_at:149:291; Interrogation_Position=1933; Antisense; CGTTGTTATCTATGCCCAGTTGGGA
>probe:Drosophila_2:1628623_at:147:203; Interrogation_Position=1957; Antisense; AACCTTCCCATTGCAAGCCAATTAG

Paste this into a BLAST search page for me
GACGACCTGGTTGCCTACAGTGATAATGCCGACGACTTGGTGCTGGTCAAGAAATCCCGCAGTGGCAAGCGCGAAGCTGCGTAAGCGTCCCACAAAGAAGAAGACCACCGCGGACCATTGAAAAGGAGGGACCACCATTAACCACCGAAGGTGCGACGCTTGAGCCAAAGACTAAACAGCCAGCTGAAGTATTCCGGCGGATTCCGGCGGATTAGCTTCAAGCTTAAGCTTCAACTGGTTCTTACTTAAGGATTGCCTTGTAGATTGCTGAACTTGCAGTTGCTCATTCGTTGTTATCTACGTTGTTATCTATGCCCAGTTGGGAAACCTTCCCATTGCAAGCCAATTAG

Full Affymetrix probeset data:

Annotations for 1628623_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720