Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628625_at:

>probe:Drosophila_2:1628625_at:355:579; Interrogation_Position=1003; Antisense; GGCCTACAAGCCATTCTTTGAGGAG
>probe:Drosophila_2:1628625_at:291:549; Interrogation_Position=1024; Antisense; GGAGGAGGCTTCTTATGGCACGAAT
>probe:Drosophila_2:1628625_at:603:671; Interrogation_Position=1075; Antisense; TAGCGCCGAATCACTTTTTGGAATC
>probe:Drosophila_2:1628625_at:646:665; Interrogation_Position=1245; Antisense; TACTTGAGTCCTTACAACTTTGCCG
>probe:Drosophila_2:1628625_at:203:321; Interrogation_Position=1266; Antisense; GCCGCCGTCGATTGCTTAGATTTTC
>probe:Drosophila_2:1628625_at:100:183; Interrogation_Position=1298; Antisense; AAAAGTCAGTCCCTCGTCATGGTAG
>probe:Drosophila_2:1628625_at:695:541; Interrogation_Position=1323; Antisense; GGATTTGCGGATACCCTTACGCGTT
>probe:Drosophila_2:1628625_at:673:475; Interrogation_Position=755; Antisense; GTTTTGGGCGACAAAGCGTATCCCT
>probe:Drosophila_2:1628625_at:551:477; Interrogation_Position=792; Antisense; GTTTTCACTTTGTAAATGCGCCCTC
>probe:Drosophila_2:1628625_at:289:51; Interrogation_Position=807; Antisense; ATGCGCCCTCCAGTGCAGAGAAGTT
>probe:Drosophila_2:1628625_at:179:63; Interrogation_Position=833; Antisense; ATGTCCATTGCCAAGAGCCTGATGA
>probe:Drosophila_2:1628625_at:600:389; Interrogation_Position=871; Antisense; GAAACGGTTTCATATACACTCCAAA
>probe:Drosophila_2:1628625_at:209:401; Interrogation_Position=899; Antisense; GACAGTCTCTACAAGTATGTGCCCA
>probe:Drosophila_2:1628625_at:406:563; Interrogation_Position=959; Antisense; GGAACCATCCAGGACGTCGTCAGTA

Paste this into a BLAST search page for me
GGCCTACAAGCCATTCTTTGAGGAGGGAGGAGGCTTCTTATGGCACGAATTAGCGCCGAATCACTTTTTGGAATCTACTTGAGTCCTTACAACTTTGCCGGCCGCCGTCGATTGCTTAGATTTTCAAAAGTCAGTCCCTCGTCATGGTAGGGATTTGCGGATACCCTTACGCGTTGTTTTGGGCGACAAAGCGTATCCCTGTTTTCACTTTGTAAATGCGCCCTCATGCGCCCTCCAGTGCAGAGAAGTTATGTCCATTGCCAAGAGCCTGATGAGAAACGGTTTCATATACACTCCAAAGACAGTCTCTACAAGTATGTGCCCAGGAACCATCCAGGACGTCGTCAGTA

Full Affymetrix probeset data:

Annotations for 1628625_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime