FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628626_at:

>probe:Drosophila_2:1628626_at:378:613; Interrogation_Position=1016; Antisense; TGAAGATTACGCGTCGGCGCGGACC
>probe:Drosophila_2:1628626_at:78:321; Interrogation_Position=1032; Antisense; GCGCGGACCGGCTAAAGTGCAATAA
>probe:Drosophila_2:1628626_at:321:251; Interrogation_Position=459; Antisense; CAATGTCAGGGATCAGCGCTGCCGG
>probe:Drosophila_2:1628626_at:726:123; Interrogation_Position=473; Antisense; AGCGCTGCCGGCAGGTCAAACGGAA
>probe:Drosophila_2:1628626_at:56:441; Interrogation_Position=499; Antisense; GATGGCCAGCTGTGCGAGATCTGTC
>probe:Drosophila_2:1628626_at:474:427; Interrogation_Position=514; Antisense; GAGATCTGTCGCCAGTTGAAGAACA
>probe:Drosophila_2:1628626_at:395:435; Interrogation_Position=541; Antisense; GAGGTGTCCGAAACGTGCAGCTACT
>probe:Drosophila_2:1628626_at:123:201; Interrogation_Position=578; Antisense; AACCGCAGCAGTACGCCTATGGCAG
>probe:Drosophila_2:1628626_at:26:355; Interrogation_Position=605; Antisense; GCAGCCAGTACAAGCGTTACCGCGA
>probe:Drosophila_2:1628626_at:439:109; Interrogation_Position=704; Antisense; AGAAGAACAGCGTCTGCTACGAGTG
>probe:Drosophila_2:1628626_at:261:95; Interrogation_Position=749; Antisense; AGATCGAACGCTGCTACGATGTGCA
>probe:Drosophila_2:1628626_at:329:505; Interrogation_Position=825; Antisense; GTCCAGCTCCGTTCACAAACGTAAG
>probe:Drosophila_2:1628626_at:332:159; Interrogation_Position=896; Antisense; ACAAGCGCACCATTAGCTACAGCTA
>probe:Drosophila_2:1628626_at:422:683; Interrogation_Position=919; Antisense; TATGCCCAGGGCACGGATCAGCAGG

Paste this into a BLAST search page for me
TGAAGATTACGCGTCGGCGCGGACCGCGCGGACCGGCTAAAGTGCAATAACAATGTCAGGGATCAGCGCTGCCGGAGCGCTGCCGGCAGGTCAAACGGAAGATGGCCAGCTGTGCGAGATCTGTCGAGATCTGTCGCCAGTTGAAGAACAGAGGTGTCCGAAACGTGCAGCTACTAACCGCAGCAGTACGCCTATGGCAGGCAGCCAGTACAAGCGTTACCGCGAAGAAGAACAGCGTCTGCTACGAGTGAGATCGAACGCTGCTACGATGTGCAGTCCAGCTCCGTTCACAAACGTAAGACAAGCGCACCATTAGCTACAGCTATATGCCCAGGGCACGGATCAGCAGG

Full Affymetrix probeset data:

Annotations for 1628626_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720