FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628627_at:

>probe:Drosophila_2:1628627_at:430:91; Interrogation_Position=1361; Antisense; AGTTAATCATGTCGCCAATCTTCCG
>probe:Drosophila_2:1628627_at:708:675; Interrogation_Position=1390; Antisense; TAGAGACCCTTCGACTTACTGGAAA
>probe:Drosophila_2:1628627_at:473:401; Interrogation_Position=1402; Antisense; GACTTACTGGAAATCCGCTGGCGGG
>probe:Drosophila_2:1628627_at:154:291; Interrogation_Position=1423; Antisense; CGGGCAGTGTGGACTATCGCTCTCG
>probe:Drosophila_2:1628627_at:454:505; Interrogation_Position=1449; Antisense; GTCCTTGCTCGATTTCACGAACGTG
>probe:Drosophila_2:1628627_at:181:383; Interrogation_Position=1467; Antisense; GAACGTGCTGCTGAAATATCTTTGG
>probe:Drosophila_2:1628627_at:500:333; Interrogation_Position=1485; Antisense; TCTTTGGACAACGAACCTGGTAATC
>probe:Drosophila_2:1628627_at:122:97; Interrogation_Position=1520; Antisense; AGATACTGCTTTGGTATTGTCCGCC
>probe:Drosophila_2:1628627_at:552:513; Interrogation_Position=1577; Antisense; GTGATCCTTCTTTATCGATTCCATA
>probe:Drosophila_2:1628627_at:278:459; Interrogation_Position=1662; Antisense; GATATTTCTTGCAACTAAACCCTAT
>probe:Drosophila_2:1628627_at:582:543; Interrogation_Position=1745; Antisense; GGATATTTCCCACGTTAGAAGTAAT
>probe:Drosophila_2:1628627_at:239:601; Interrogation_Position=1803; Antisense; TGTTTGTAAAATTCCCCGTATTCAG
>probe:Drosophila_2:1628627_at:8:689; Interrogation_Position=1842; Antisense; TATATGTTTTATCATTTCTGTCCCC
>probe:Drosophila_2:1628627_at:555:243; Interrogation_Position=1880; Antisense; AATTCAATGCTCACTTCCAAACAAA

Paste this into a BLAST search page for me
AGTTAATCATGTCGCCAATCTTCCGTAGAGACCCTTCGACTTACTGGAAAGACTTACTGGAAATCCGCTGGCGGGCGGGCAGTGTGGACTATCGCTCTCGGTCCTTGCTCGATTTCACGAACGTGGAACGTGCTGCTGAAATATCTTTGGTCTTTGGACAACGAACCTGGTAATCAGATACTGCTTTGGTATTGTCCGCCGTGATCCTTCTTTATCGATTCCATAGATATTTCTTGCAACTAAACCCTATGGATATTTCCCACGTTAGAAGTAATTGTTTGTAAAATTCCCCGTATTCAGTATATGTTTTATCATTTCTGTCCCCAATTCAATGCTCACTTCCAAACAAA

Full Affymetrix probeset data:

Annotations for 1628627_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720