FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628628_at:

>probe:Drosophila_2:1628628_at:334:103; Interrogation_Position=2363; Antisense; AGACTTTGCTCTCGGAAATTGCCAA
>probe:Drosophila_2:1628628_at:606:25; Interrogation_Position=2423; Antisense; ATACGGGCAGGGTATCCGGATTCCA
>probe:Drosophila_2:1628628_at:204:543; Interrogation_Position=2440; Antisense; GGATTCCAGCTTCGCGAAGCTCTTA
>probe:Drosophila_2:1628628_at:136:379; Interrogation_Position=2455; Antisense; GAAGCTCTTAACTCTGCTGGCTATC
>probe:Drosophila_2:1628628_at:415:621; Interrogation_Position=2469; Antisense; TGCTGGCTATCATCTAAACAATCGT
>probe:Drosophila_2:1628628_at:45:43; Interrogation_Position=2489; Antisense; ATCGTGTTCTAAATGTTTTGGGCCA
>probe:Drosophila_2:1628628_at:723:521; Interrogation_Position=2508; Antisense; GGGCCATCGATATGGTTCTCGTGAT
>probe:Drosophila_2:1628628_at:66:59; Interrogation_Position=2549; Antisense; ATGATTTTATCATGTGCGCTGTTAA
>probe:Drosophila_2:1628628_at:690:685; Interrogation_Position=2592; Antisense; TATATTCAAGGAGCGCGACACCGAG
>probe:Drosophila_2:1628628_at:124:389; Interrogation_Position=2623; Antisense; GAAACAGCCACCTTTACGTTGGAGG
>probe:Drosophila_2:1628628_at:487:239; Interrogation_Position=2808; Antisense; AATCACGTCATTGTTTGTATGTCGA
>probe:Drosophila_2:1628628_at:494:295; Interrogation_Position=2846; Antisense; CGAATTTAATGACTTGTTGACCCAA
>probe:Drosophila_2:1628628_at:408:273; Interrogation_Position=2886; Antisense; CATTTGCATTTGTAACGTGAGCCGA
>probe:Drosophila_2:1628628_at:654:137; Interrogation_Position=2900; Antisense; ACGTGAGCCGATGTTAACTTATTAA

Paste this into a BLAST search page for me
AGACTTTGCTCTCGGAAATTGCCAAATACGGGCAGGGTATCCGGATTCCAGGATTCCAGCTTCGCGAAGCTCTTAGAAGCTCTTAACTCTGCTGGCTATCTGCTGGCTATCATCTAAACAATCGTATCGTGTTCTAAATGTTTTGGGCCAGGGCCATCGATATGGTTCTCGTGATATGATTTTATCATGTGCGCTGTTAATATATTCAAGGAGCGCGACACCGAGGAAACAGCCACCTTTACGTTGGAGGAATCACGTCATTGTTTGTATGTCGACGAATTTAATGACTTGTTGACCCAACATTTGCATTTGTAACGTGAGCCGAACGTGAGCCGATGTTAACTTATTAA

Full Affymetrix probeset data:

Annotations for 1628628_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720