FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628629_at:

>probe:Drosophila_2:1628629_at:404:169; Interrogation_Position=119; Antisense; AAAGGCAGGCCTTTGGCGTCCACTA
>probe:Drosophila_2:1628629_at:339:279; Interrogation_Position=141; Antisense; CTACCAGTGTGAGTTGTTTCGCTTT
>probe:Drosophila_2:1628629_at:324:479; Interrogation_Position=156; Antisense; GTTTCGCTTTATGGAGCCCTTCTAT
>probe:Drosophila_2:1628629_at:152:319; Interrogation_Position=194; Antisense; GCCGACCGGTGCAGTTCAACAATAT
>probe:Drosophila_2:1628629_at:186:291; Interrogation_Position=255; Antisense; CGAGAACCGCTTCAAGGCCAAGTAC
>probe:Drosophila_2:1628629_at:607:437; Interrogation_Position=304; Antisense; GAGGACGATCGCGTCTATCTCGATC
>probe:Drosophila_2:1628629_at:398:449; Interrogation_Position=325; Antisense; GATCCTTACTGGGTGCTGGACAGCA
>probe:Drosophila_2:1628629_at:679:613; Interrogation_Position=389; Antisense; TGAAGAGCGCCATTATCTCGGCCGA
>probe:Drosophila_2:1628629_at:105:211; Interrogation_Position=462; Antisense; AAGAAGGCACCTTCACGACTTCGTC
>probe:Drosophila_2:1628629_at:546:445; Interrogation_Position=487; Antisense; GATCCACCGTTTGTGCTGGACAAAT
>probe:Drosophila_2:1628629_at:117:101; Interrogation_Position=567; Antisense; AGAGTACCATTTTCCCACACTGTTT
>probe:Drosophila_2:1628629_at:268:157; Interrogation_Position=583; Antisense; ACACTGTTTCACCTTTTTGTGCAAA
>probe:Drosophila_2:1628629_at:697:375; Interrogation_Position=64; Antisense; GAAGAGCCCTATGAGCTGACCAGGT
>probe:Drosophila_2:1628629_at:701:609; Interrogation_Position=80; Antisense; TGACCAGGTTTTCGCGTGCAATCGA

Paste this into a BLAST search page for me
AAAGGCAGGCCTTTGGCGTCCACTACTACCAGTGTGAGTTGTTTCGCTTTGTTTCGCTTTATGGAGCCCTTCTATGCCGACCGGTGCAGTTCAACAATATCGAGAACCGCTTCAAGGCCAAGTACGAGGACGATCGCGTCTATCTCGATCGATCCTTACTGGGTGCTGGACAGCATGAAGAGCGCCATTATCTCGGCCGAAAGAAGGCACCTTCACGACTTCGTCGATCCACCGTTTGTGCTGGACAAATAGAGTACCATTTTCCCACACTGTTTACACTGTTTCACCTTTTTGTGCAAAGAAGAGCCCTATGAGCTGACCAGGTTGACCAGGTTTTCGCGTGCAATCGA

Full Affymetrix probeset data:

Annotations for 1628629_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720