FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628630_at:

>probe:Drosophila_2:1628630_at:454:17; Interrogation_Position=119; Antisense; ATTTCGAGGGCGGTGATTTCAACTT
>probe:Drosophila_2:1628630_at:717:15; Interrogation_Position=134; Antisense; ATTTCAACTTTGATGACGACGCGGA
>probe:Drosophila_2:1628630_at:460:611; Interrogation_Position=147; Antisense; TGACGACGCGGAGGATGACCAATTT
>probe:Drosophila_2:1628630_at:364:729; Interrogation_Position=170; Antisense; TTGTGGCTACCAACTCAGGACGAAA
>probe:Drosophila_2:1628630_at:707:391; Interrogation_Position=191; Antisense; GAAAGCGCCTATTCAGCAAGGAGCT
>probe:Drosophila_2:1628630_at:345:419; Interrogation_Position=211; Antisense; GAGCTGCGCTGCATGATGTTCGGAT
>probe:Drosophila_2:1628630_at:588:97; Interrogation_Position=270; Antisense; AGATCTGCTGGAAGACCTGGTCATT
>probe:Drosophila_2:1628630_at:14:687; Interrogation_Position=298; Antisense; TATATAGCTGAGACCACTCACCGGG
>probe:Drosophila_2:1628630_at:123:187; Interrogation_Position=339; Antisense; AACAGGCCGTGTTCAAGTCGAAGAC
>probe:Drosophila_2:1628630_at:670:589; Interrogation_Position=374; Antisense; TGGTGCGCAAAGATCCCCGAAAGTA
>probe:Drosophila_2:1628630_at:605:371; Interrogation_Position=408; Antisense; GAAGGATCTTCTGACCATGAACGAG
>probe:Drosophila_2:1628630_at:147:519; Interrogation_Position=475; Antisense; GTGGGCACCGAAGGCAAGCTCAAAT
>probe:Drosophila_2:1628630_at:451:311; Interrogation_Position=539; Antisense; GCCAAACCTAGCAGTTAGCTCCAAG
>probe:Drosophila_2:1628630_at:383:373; Interrogation_Position=77; Antisense; GAAGTCTGAGCACTATGGCCTCAAA

Paste this into a BLAST search page for me
ATTTCGAGGGCGGTGATTTCAACTTATTTCAACTTTGATGACGACGCGGATGACGACGCGGAGGATGACCAATTTTTGTGGCTACCAACTCAGGACGAAAGAAAGCGCCTATTCAGCAAGGAGCTGAGCTGCGCTGCATGATGTTCGGATAGATCTGCTGGAAGACCTGGTCATTTATATAGCTGAGACCACTCACCGGGAACAGGCCGTGTTCAAGTCGAAGACTGGTGCGCAAAGATCCCCGAAAGTAGAAGGATCTTCTGACCATGAACGAGGTGGGCACCGAAGGCAAGCTCAAATGCCAAACCTAGCAGTTAGCTCCAAGGAAGTCTGAGCACTATGGCCTCAAA

Full Affymetrix probeset data:

Annotations for 1628630_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720