FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628631_at:

>probe:Drosophila_2:1628631_at:545:1; Interrogation_Position=143; Antisense; ATTCGAGTGTAAGAGCCCGTTGCGT
>probe:Drosophila_2:1628631_at:543:395; Interrogation_Position=15; Antisense; GAAATTCGTGATATTGCTATCCTTG
>probe:Drosophila_2:1628631_at:133:415; Interrogation_Position=155; Antisense; GAGCCCGTTGCGTAAACTATGAGAC
>probe:Drosophila_2:1628631_at:730:103; Interrogation_Position=178; Antisense; ACCATAGGTTGCGAGGTCATCGGAA
>probe:Drosophila_2:1628631_at:631:557; Interrogation_Position=199; Antisense; GGAAATTTCTTCACCGACAGGAAAG
>probe:Drosophila_2:1628631_at:114:561; Interrogation_Position=218; Antisense; GGAAAGTGTCCGATTGTGGCAATAA
>probe:Drosophila_2:1628631_at:234:7; Interrogation_Position=27; Antisense; ATTGCTATCCTTGATGTGCATCGGA
>probe:Drosophila_2:1628631_at:667:647; Interrogation_Position=275; Antisense; TCAAAGGATTTACTTTTGCAACCGA
>probe:Drosophila_2:1628631_at:572:281; Interrogation_Position=345; Antisense; CGGAAATTACTTTCGAGCCAAAGAT
>probe:Drosophila_2:1628631_at:429:507; Interrogation_Position=42; Antisense; GTGCATCGGAATTGGTTATGCCCAA
>probe:Drosophila_2:1628631_at:131:205; Interrogation_Position=480; Antisense; AAGCGAAGTCGAAAGCATCTCGAAT
>probe:Drosophila_2:1628631_at:722:473; Interrogation_Position=56; Antisense; GTTATGCCCAACAACAGTCGGAAGT
>probe:Drosophila_2:1628631_at:316:89; Interrogation_Position=78; Antisense; AGTCAAATGCTTCATGGACGCCATT
>probe:Drosophila_2:1628631_at:547:555; Interrogation_Position=93; Antisense; GGACGCCATTCCTGTGGGCGAATGT

Paste this into a BLAST search page for me
ATTCGAGTGTAAGAGCCCGTTGCGTGAAATTCGTGATATTGCTATCCTTGGAGCCCGTTGCGTAAACTATGAGACACCATAGGTTGCGAGGTCATCGGAAGGAAATTTCTTCACCGACAGGAAAGGGAAAGTGTCCGATTGTGGCAATAAATTGCTATCCTTGATGTGCATCGGATCAAAGGATTTACTTTTGCAACCGACGGAAATTACTTTCGAGCCAAAGATGTGCATCGGAATTGGTTATGCCCAAAAGCGAAGTCGAAAGCATCTCGAATGTTATGCCCAACAACAGTCGGAAGTAGTCAAATGCTTCATGGACGCCATTGGACGCCATTCCTGTGGGCGAATGT

Full Affymetrix probeset data:

Annotations for 1628631_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720