FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628632_at:

>probe:Drosophila_2:1628632_at:475:349; Interrogation_Position=536; Antisense; GCAGGAGTGTTTTGAAGCCATGATA
>probe:Drosophila_2:1628632_at:42:141; Interrogation_Position=606; Antisense; ACGGACGAGCAGAACACGGCACTTT
>probe:Drosophila_2:1628632_at:464:279; Interrogation_Position=636; Antisense; CTACCCAAGAGCCAGTGTGATGTTG
>probe:Drosophila_2:1628632_at:211:499; Interrogation_Position=665; Antisense; GTCTGTTCTGAATCCGATGGCTGAT
>probe:Drosophila_2:1628632_at:225:441; Interrogation_Position=680; Antisense; GATGGCTGATGAGTTTGTTCCGCGT
>probe:Drosophila_2:1628632_at:47:727; Interrogation_Position=694; Antisense; TTGTTCCGCGTTGTCATGTTATAGA
>probe:Drosophila_2:1628632_at:358:647; Interrogation_Position=707; Antisense; TCATGTTATAGATTTCCCTGCCTCA
>probe:Drosophila_2:1628632_at:702:519; Interrogation_Position=793; Antisense; GTGGACCTCATACGCGAAAAACCTT
>probe:Drosophila_2:1628632_at:612:613; Interrogation_Position=826; Antisense; TGAAGACCCATTGCTAAGACTAGAC
>probe:Drosophila_2:1628632_at:612:403; Interrogation_Position=848; Antisense; GACTAACAGATTCCGCTAATGAGAT
>probe:Drosophila_2:1628632_at:499:725; Interrogation_Position=878; Antisense; TTGATATTCTGACCAAGTTGAGCCA
>probe:Drosophila_2:1628632_at:192:421; Interrogation_Position=916; Antisense; GAGCAGTGGCTCATGAATATCTTAT
>probe:Drosophila_2:1628632_at:259:135; Interrogation_Position=983; Antisense; ACAAACTCCAAATGCTGGCGACCGA
>probe:Drosophila_2:1628632_at:283:331; Interrogation_Position=996; Antisense; GCTGGCGACCGAAATGCAAACGAAT

Paste this into a BLAST search page for me
GCAGGAGTGTTTTGAAGCCATGATAACGGACGAGCAGAACACGGCACTTTCTACCCAAGAGCCAGTGTGATGTTGGTCTGTTCTGAATCCGATGGCTGATGATGGCTGATGAGTTTGTTCCGCGTTTGTTCCGCGTTGTCATGTTATAGATCATGTTATAGATTTCCCTGCCTCAGTGGACCTCATACGCGAAAAACCTTTGAAGACCCATTGCTAAGACTAGACGACTAACAGATTCCGCTAATGAGATTTGATATTCTGACCAAGTTGAGCCAGAGCAGTGGCTCATGAATATCTTATACAAACTCCAAATGCTGGCGACCGAGCTGGCGACCGAAATGCAAACGAAT

Full Affymetrix probeset data:

Annotations for 1628632_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720