FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628633_at:

>probe:Drosophila_2:1628633_at:581:705; Interrogation_Position=118; Antisense; TTACCCTGGTTGTGAGTGCCGATAC
>probe:Drosophila_2:1628633_at:83:627; Interrogation_Position=134; Antisense; TGCCGATACGGACTCGGATGCCGAT
>probe:Drosophila_2:1628633_at:153:627; Interrogation_Position=152; Antisense; TGCCGATTCGGATTCATCCGCCGAT
>probe:Drosophila_2:1628633_at:527:713; Interrogation_Position=182; Antisense; TTCATCCGCCGATTCCGATGAGAAT
>probe:Drosophila_2:1628633_at:91:365; Interrogation_Position=203; Antisense; GAATACAACCGCATCCGGATCGATA
>probe:Drosophila_2:1628633_at:34:545; Interrogation_Position=219; Antisense; GGATCGATAGTAACCTCAACCACGG
>probe:Drosophila_2:1628633_at:390:141; Interrogation_Position=240; Antisense; ACGGAGTCCAGTGCCACGAACAGTT
>probe:Drosophila_2:1628633_at:410:541; Interrogation_Position=267; Antisense; GGTTCCTCAGATGATGCTTCTGGCA
>probe:Drosophila_2:1628633_at:304:619; Interrogation_Position=281; Antisense; TGCTTCTGGCAGTAGTTCCGATGTG
>probe:Drosophila_2:1628633_at:634:717; Interrogation_Position=296; Antisense; TTCCGATGTGGACGATGGTTCCGAT
>probe:Drosophila_2:1628633_at:58:443; Interrogation_Position=321; Antisense; GATGATACTGATTCTGGATCCGATA
>probe:Drosophila_2:1628633_at:405:705; Interrogation_Position=350; Antisense; TTATGATACACCTACTACAGCTCCA
>probe:Drosophila_2:1628633_at:241:159; Interrogation_Position=562; Antisense; ACAACAATTCCAGGAGGCGTGGTTA
>probe:Drosophila_2:1628633_at:591:465; Interrogation_Position=666; Antisense; GATTGGTGCATTGGTCTGATTCGAA

Paste this into a BLAST search page for me
TTACCCTGGTTGTGAGTGCCGATACTGCCGATACGGACTCGGATGCCGATTGCCGATTCGGATTCATCCGCCGATTTCATCCGCCGATTCCGATGAGAATGAATACAACCGCATCCGGATCGATAGGATCGATAGTAACCTCAACCACGGACGGAGTCCAGTGCCACGAACAGTTGGTTCCTCAGATGATGCTTCTGGCATGCTTCTGGCAGTAGTTCCGATGTGTTCCGATGTGGACGATGGTTCCGATGATGATACTGATTCTGGATCCGATATTATGATACACCTACTACAGCTCCAACAACAATTCCAGGAGGCGTGGTTAGATTGGTGCATTGGTCTGATTCGAA

Full Affymetrix probeset data:

Annotations for 1628633_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720