Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628634_at:

>probe:Drosophila_2:1628634_at:245:81; Interrogation_Position=1031; Antisense; AGGTGGTGTTCTACTCATACGGCTT
>probe:Drosophila_2:1628634_at:26:669; Interrogation_Position=1048; Antisense; TACGGCTTGGGTTTTGTGTACCTAT
>probe:Drosophila_2:1628634_at:301:461; Interrogation_Position=1077; Antisense; GATTATGCTGGTTACCGGCAACTTC
>probe:Drosophila_2:1628634_at:278:649; Interrogation_Position=1103; Antisense; TCAGCGGCTTTGCATTCTGTTTGGA
>probe:Drosophila_2:1628634_at:729:641; Interrogation_Position=1118; Antisense; TCTGTTTGGAGCATCCCGTTGAGAC
>probe:Drosophila_2:1628634_at:69:675; Interrogation_Position=1150; Antisense; TATGGCTTCCTCTTTAGTTTGTCCG
>probe:Drosophila_2:1628634_at:627:91; Interrogation_Position=1165; Antisense; AGTTTGTCCGGCTATCTGGGCATTC
>probe:Drosophila_2:1628634_at:263:595; Interrogation_Position=1260; Antisense; TGTGACTATAGCCTTCTCCTTTGTG
>probe:Drosophila_2:1628634_at:562:111; Interrogation_Position=1291; Antisense; AGCAAGCCCTTTACCTTACAATATC
>probe:Drosophila_2:1628634_at:425:709; Interrogation_Position=1306; Antisense; TTACAATATCTGTGGTCGGGCCTCA
>probe:Drosophila_2:1628634_at:405:467; Interrogation_Position=1333; Antisense; GTTGTCCTGGGCATATATCTCAATG
>probe:Drosophila_2:1628634_at:22:73; Interrogation_Position=1369; Antisense; AGGAACAAGCTGACGTTGGCCGACG
>probe:Drosophila_2:1628634_at:530:249; Interrogation_Position=1411; Antisense; CAATTTGGAGCCAAGGTTGCCCGCT
>probe:Drosophila_2:1628634_at:241:295; Interrogation_Position=1439; Antisense; CGAGTCGCAAATTCCTCATCGAAGT

Paste this into a BLAST search page for me
AGGTGGTGTTCTACTCATACGGCTTTACGGCTTGGGTTTTGTGTACCTATGATTATGCTGGTTACCGGCAACTTCTCAGCGGCTTTGCATTCTGTTTGGATCTGTTTGGAGCATCCCGTTGAGACTATGGCTTCCTCTTTAGTTTGTCCGAGTTTGTCCGGCTATCTGGGCATTCTGTGACTATAGCCTTCTCCTTTGTGAGCAAGCCCTTTACCTTACAATATCTTACAATATCTGTGGTCGGGCCTCAGTTGTCCTGGGCATATATCTCAATGAGGAACAAGCTGACGTTGGCCGACGCAATTTGGAGCCAAGGTTGCCCGCTCGAGTCGCAAATTCCTCATCGAAGT

Full Affymetrix probeset data:

Annotations for 1628634_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime