FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628635_at:

>probe:Drosophila_2:1628635_at:692:115; Interrogation_Position=1017; Antisense; AGCATAGTTCATGCCAGGCTTACAC
>probe:Drosophila_2:1628635_at:676:71; Interrogation_Position=1032; Antisense; AGGCTTACACACTTAAGGCGCCATC
>probe:Drosophila_2:1628635_at:479:491; Interrogation_Position=1076; Antisense; GTAAATCCCGAACCCACACAAATAG
>probe:Drosophila_2:1628635_at:472:365; Interrogation_Position=1108; Antisense; GAATCAGCAGCTAGGGACTGCCGCC
>probe:Drosophila_2:1628635_at:258:385; Interrogation_Position=1139; Antisense; GAACACCTGGCGTCGTTTAATCTAT
>probe:Drosophila_2:1628635_at:95:611; Interrogation_Position=1173; Antisense; TGACTGCCACTGTCGTATTAATACT
>probe:Drosophila_2:1628635_at:402:189; Interrogation_Position=1268; Antisense; AACTAAACTGCCTAACTCTGAACTG
>probe:Drosophila_2:1628635_at:615:641; Interrogation_Position=1284; Antisense; TCTGAACTGCCGCTAGGCGCAGAAA
>probe:Drosophila_2:1628635_at:351:395; Interrogation_Position=1351; Antisense; GAAATGCCGCATTTATTCCGAACAT
>probe:Drosophila_2:1628635_at:429:423; Interrogation_Position=798; Antisense; GAGAACTACGAGGTCGTTGCGCACC
>probe:Drosophila_2:1628635_at:20:205; Interrogation_Position=913; Antisense; AAGCTGCATGCCAAATATTCTGAAT
>probe:Drosophila_2:1628635_at:49:233; Interrogation_Position=935; Antisense; AATGCTGAATGCTGAGGCAACCGTA
>probe:Drosophila_2:1628635_at:129:239; Interrogation_Position=959; Antisense; AATCAGTGCAATACTCGGAGGGCCG
>probe:Drosophila_2:1628635_at:14:289; Interrogation_Position=974; Antisense; CGGAGGGCCGTCTAATTTATCTATT

Paste this into a BLAST search page for me
AGCATAGTTCATGCCAGGCTTACACAGGCTTACACACTTAAGGCGCCATCGTAAATCCCGAACCCACACAAATAGGAATCAGCAGCTAGGGACTGCCGCCGAACACCTGGCGTCGTTTAATCTATTGACTGCCACTGTCGTATTAATACTAACTAAACTGCCTAACTCTGAACTGTCTGAACTGCCGCTAGGCGCAGAAAGAAATGCCGCATTTATTCCGAACATGAGAACTACGAGGTCGTTGCGCACCAAGCTGCATGCCAAATATTCTGAATAATGCTGAATGCTGAGGCAACCGTAAATCAGTGCAATACTCGGAGGGCCGCGGAGGGCCGTCTAATTTATCTATT

Full Affymetrix probeset data:

Annotations for 1628635_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720