FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628637_at:

>probe:Drosophila_2:1628637_at:617:655; Interrogation_Position=101; Antisense; TAATCGCGGCACAAACGGGCACAAA
>probe:Drosophila_2:1628637_at:251:355; Interrogation_Position=109; Antisense; GCACAAACGGGCACAAAGCACGAGA
>probe:Drosophila_2:1628637_at:254:209; Interrogation_Position=124; Antisense; AAGCACGAGAAGATTGTCCTGAAGA
>probe:Drosophila_2:1628637_at:718:465; Interrogation_Position=135; Antisense; GATTGTCCTGAAGAAGTGGTACACA
>probe:Drosophila_2:1628637_at:588:517; Interrogation_Position=150; Antisense; GTGGTACACAATCTTCAAGGACCCG
>probe:Drosophila_2:1628637_at:35:235; Interrogation_Position=159; Antisense; AATCTTCAAGGACCCGATTCGCCTA
>probe:Drosophila_2:1628637_at:38:305; Interrogation_Position=172; Antisense; CCGATTCGCCTATCTGACTATGAAA
>probe:Drosophila_2:1628637_at:265:401; Interrogation_Position=187; Antisense; GACTATGAAATTCACGATGGCATGA
>probe:Drosophila_2:1628637_at:668:583; Interrogation_Position=204; Antisense; TGGCATGAATCTGGAACTTTACTAC
>probe:Drosophila_2:1628637_at:561:705; Interrogation_Position=222; Antisense; TTACTACCAATAAAACTGCAAGGGA
>probe:Drosophila_2:1628637_at:703:659; Interrogation_Position=23; Antisense; TAACGTGTAACGATCGTCTTGGCAA
>probe:Drosophila_2:1628637_at:430:109; Interrogation_Position=47; Antisense; AGAAGGTGCGCGTCAAGTGCAACCC
>probe:Drosophila_2:1628637_at:470:83; Interrogation_Position=62; Antisense; AGTGCAACCCGGACGACACGATTGG
>probe:Drosophila_2:1628637_at:511:527; Interrogation_Position=86; Antisense; GGGACCTCAAGAAACTAATCGCGGC

Paste this into a BLAST search page for me
TAATCGCGGCACAAACGGGCACAAAGCACAAACGGGCACAAAGCACGAGAAAGCACGAGAAGATTGTCCTGAAGAGATTGTCCTGAAGAAGTGGTACACAGTGGTACACAATCTTCAAGGACCCGAATCTTCAAGGACCCGATTCGCCTACCGATTCGCCTATCTGACTATGAAAGACTATGAAATTCACGATGGCATGATGGCATGAATCTGGAACTTTACTACTTACTACCAATAAAACTGCAAGGGATAACGTGTAACGATCGTCTTGGCAAAGAAGGTGCGCGTCAAGTGCAACCCAGTGCAACCCGGACGACACGATTGGGGGACCTCAAGAAACTAATCGCGGC

Full Affymetrix probeset data:

Annotations for 1628637_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720