FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628638_at:

>probe:Drosophila_2:1628638_at:677:21; Interrogation_Position=1025; Antisense; ATATCCGTCAATCACAACTGGTTCA
>probe:Drosophila_2:1628638_at:521:573; Interrogation_Position=1052; Antisense; GGCTGCAACATATCCATGGTCTGGC
>probe:Drosophila_2:1628638_at:618:577; Interrogation_Position=1099; Antisense; GGCCGTTTGCAATGAGATCTCCGAC
>probe:Drosophila_2:1628638_at:703:433; Interrogation_Position=1168; Antisense; GAGGGCCAGCTTTGGTATCAACTAC
>probe:Drosophila_2:1628638_at:548:667; Interrogation_Position=1209; Antisense; TACTGGAGTTTATAGCCGCTCGCCG
>probe:Drosophila_2:1628638_at:152:255; Interrogation_Position=1239; Antisense; CAGAGGGAACCGTAGCCACCAAATT
>probe:Drosophila_2:1628638_at:254:239; Interrogation_Position=1305; Antisense; AATACGATCTCGAGTGCTTATGGAA
>probe:Drosophila_2:1628638_at:453:215; Interrogation_Position=1328; Antisense; AAGATCACCCGGACTCTAACAGAGG
>probe:Drosophila_2:1628638_at:218:515; Interrogation_Position=1366; Antisense; GTGTAGTCCCCTCCAATTAGAAGAT
>probe:Drosophila_2:1628638_at:553:73; Interrogation_Position=1398; Antisense; AGGGATTGCTCGCTCGTTTAGAGTT
>probe:Drosophila_2:1628638_at:416:659; Interrogation_Position=1429; Antisense; TAAGCACAGCTCAAATGCCTCGGCA
>probe:Drosophila_2:1628638_at:263:709; Interrogation_Position=943; Antisense; TTACACCATTAATCAGCGGGCCAAT
>probe:Drosophila_2:1628638_at:430:231; Interrogation_Position=965; Antisense; AATGAAGCTGTTTTCGTGCCCAGTG
>probe:Drosophila_2:1628638_at:294:299; Interrogation_Position=983; Antisense; CCCAGTGGCTGGTTTCATCAGGTGT

Paste this into a BLAST search page for me
ATATCCGTCAATCACAACTGGTTCAGGCTGCAACATATCCATGGTCTGGCGGCCGTTTGCAATGAGATCTCCGACGAGGGCCAGCTTTGGTATCAACTACTACTGGAGTTTATAGCCGCTCGCCGCAGAGGGAACCGTAGCCACCAAATTAATACGATCTCGAGTGCTTATGGAAAAGATCACCCGGACTCTAACAGAGGGTGTAGTCCCCTCCAATTAGAAGATAGGGATTGCTCGCTCGTTTAGAGTTTAAGCACAGCTCAAATGCCTCGGCATTACACCATTAATCAGCGGGCCAATAATGAAGCTGTTTTCGTGCCCAGTGCCCAGTGGCTGGTTTCATCAGGTGT

Full Affymetrix probeset data:

Annotations for 1628638_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720