FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628639_at:

>probe:Drosophila_2:1628639_at:664:465; Interrogation_Position=112; Antisense; GTTGGCTTTAATTCCGACTCTGATC
>probe:Drosophila_2:1628639_at:666:449; Interrogation_Position=13; Antisense; GATCGAATCAAGTGCCGGACTATAT
>probe:Drosophila_2:1628639_at:377:339; Interrogation_Position=140; Antisense; GCTCATCCCAGCACAGTGGTGGTGA
>probe:Drosophila_2:1628639_at:293:67; Interrogation_Position=165; Antisense; ATGGCGTCTGTCTGACTTGTCCCAA
>probe:Drosophila_2:1628639_at:191:403; Interrogation_Position=178; Antisense; GACTTGTCCCAATCCGAATGGTGAA
>probe:Drosophila_2:1628639_at:321:229; Interrogation_Position=194; Antisense; AATGGTGAACCCGTCTACCTGGATG
>probe:Drosophila_2:1628639_at:467:589; Interrogation_Position=213; Antisense; TGGATGGCCAGCAGTACCGCAGCTT
>probe:Drosophila_2:1628639_at:638:45; Interrogation_Position=244; Antisense; ATCCCCTGGCGATGGTAATGTGGTC
>probe:Drosophila_2:1628639_at:577:489; Interrogation_Position=258; Antisense; GTAATGTGGTCATTTCCCGTGGAAA
>probe:Drosophila_2:1628639_at:163:43; Interrogation_Position=335; Antisense; ATCGTCAATGGCAGATGTCAGCACT
>probe:Drosophila_2:1628639_at:465:111; Interrogation_Position=354; Antisense; AGCACTGCAACGTGGATCCCTATTA
>probe:Drosophila_2:1628639_at:63:329; Interrogation_Position=43; Antisense; GCGTGAGAGTCGATACGGTCATCTA
>probe:Drosophila_2:1628639_at:146:291; Interrogation_Position=58; Antisense; CGGTCATCTATCTATCGGCTTTAAT
>probe:Drosophila_2:1628639_at:595:373; Interrogation_Position=85; Antisense; GAAGTACCTGACGTGTGTGCTGCTC

Paste this into a BLAST search page for me
GTTGGCTTTAATTCCGACTCTGATCGATCGAATCAAGTGCCGGACTATATGCTCATCCCAGCACAGTGGTGGTGAATGGCGTCTGTCTGACTTGTCCCAAGACTTGTCCCAATCCGAATGGTGAAAATGGTGAACCCGTCTACCTGGATGTGGATGGCCAGCAGTACCGCAGCTTATCCCCTGGCGATGGTAATGTGGTCGTAATGTGGTCATTTCCCGTGGAAAATCGTCAATGGCAGATGTCAGCACTAGCACTGCAACGTGGATCCCTATTAGCGTGAGAGTCGATACGGTCATCTACGGTCATCTATCTATCGGCTTTAATGAAGTACCTGACGTGTGTGCTGCTC

Full Affymetrix probeset data:

Annotations for 1628639_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720