Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628640_at:

>probe:Drosophila_2:1628640_at:120:165; Interrogation_Position=252; Antisense; AAATCAGCTTCAGGGCCAGATTCCA
>probe:Drosophila_2:1628640_at:21:465; Interrogation_Position=270; Antisense; GATTCCATCACAAACGGATCCGGCA
>probe:Drosophila_2:1628640_at:547:569; Interrogation_Position=291; Antisense; GGCATTCAAGCCCTCGTACAAGATG
>probe:Drosophila_2:1628640_at:140:427; Interrogation_Position=319; Antisense; GAGATGGAGACCAACTTCACGCCCA
>probe:Drosophila_2:1628640_at:198:219; Interrogation_Position=363; Antisense; AAGTGTGTCCAGTTTACCGTCTACT
>probe:Drosophila_2:1628640_at:451:269; Interrogation_Position=436; Antisense; GGAAACTCGGTTCAGTACCTTCAGC
>probe:Drosophila_2:1628640_at:471:453; Interrogation_Position=477; Antisense; GATCATAGTGCCCATTTCGCCGTAC
>probe:Drosophila_2:1628640_at:467:357; Interrogation_Position=553; Antisense; GCACAGCCAGACTTCGGAGGACGAA
>probe:Drosophila_2:1628640_at:221:383; Interrogation_Position=575; Antisense; GAACGGCCACTGTTTTGAGTGCTCT
>probe:Drosophila_2:1628640_at:106:193; Interrogation_Position=607; Antisense; AACTACGCAGCTCTGCAGGGTTACG
>probe:Drosophila_2:1628640_at:288:81; Interrogation_Position=623; Antisense; AGGGTTACGCCAGTGGGTCCATCAA
>probe:Drosophila_2:1628640_at:366:539; Interrogation_Position=677; Antisense; GGATCAATCGCGAGGCCAAGGACAA
>probe:Drosophila_2:1628640_at:258:283; Interrogation_Position=783; Antisense; CTCCGTCAATAGTCCACATGTGTAT
>probe:Drosophila_2:1628640_at:374:153; Interrogation_Position=798; Antisense; ACATGTGTATCTGCGGACCAGGTCA

Paste this into a BLAST search page for me
AAATCAGCTTCAGGGCCAGATTCCAGATTCCATCACAAACGGATCCGGCAGGCATTCAAGCCCTCGTACAAGATGGAGATGGAGACCAACTTCACGCCCAAAGTGTGTCCAGTTTACCGTCTACTGGAAACTCGGTTCAGTACCTTCAGCGATCATAGTGCCCATTTCGCCGTACGCACAGCCAGACTTCGGAGGACGAAGAACGGCCACTGTTTTGAGTGCTCTAACTACGCAGCTCTGCAGGGTTACGAGGGTTACGCCAGTGGGTCCATCAAGGATCAATCGCGAGGCCAAGGACAACTCCGTCAATAGTCCACATGTGTATACATGTGTATCTGCGGACCAGGTCA

Full Affymetrix probeset data:

Annotations for 1628640_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime