FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628642_at:

>probe:Drosophila_2:1628642_at:559:515; Interrogation_Position=1024; Antisense; GTGTACACCAAGAGTTCGCACCTCA
>probe:Drosophila_2:1628642_at:9:719; Interrogation_Position=1038; Antisense; TTCGCACCTCAAGGCGCACAAAAGG
>probe:Drosophila_2:1628642_at:727:665; Interrogation_Position=1068; Antisense; TACAGGTGAGAAGCCGTACGTGTGC
>probe:Drosophila_2:1628642_at:625:433; Interrogation_Position=1099; Antisense; GAGGGCTGCATCTGGCGCTTCGCTC
>probe:Drosophila_2:1628642_at:354:531; Interrogation_Position=1124; Antisense; GGTCGGATGAGCTGACCCGGCACTA
>probe:Drosophila_2:1628642_at:412:53; Interrogation_Position=646; Antisense; ATGCAGGACTACGAGAGCAAGTTCT
>probe:Drosophila_2:1628642_at:121:253; Interrogation_Position=663; Antisense; CAAGTTCTCGTTGCTGAGTCTGTTC
>probe:Drosophila_2:1628642_at:382:431; Interrogation_Position=678; Antisense; GAGTCTGTTCAAGAATCCCTACAAG
>probe:Drosophila_2:1628642_at:544:235; Interrogation_Position=691; Antisense; AATCCCTACAAGTTTGCCGGCGGAG
>probe:Drosophila_2:1628642_at:172:121; Interrogation_Position=787; Antisense; AGCTGGAAGAGCTACGCCGGATCAG
>probe:Drosophila_2:1628642_at:228:661; Interrogation_Position=876; Antisense; TAACAGCAGCTTCAGTGGGATTAAC
>probe:Drosophila_2:1628642_at:309:197; Interrogation_Position=955; Antisense; AACGGCGGCTACAATGATCTCTCCA
>probe:Drosophila_2:1628642_at:537:605; Interrogation_Position=969; Antisense; TGATCTCTCCAAGAACCGCAAGGTG
>probe:Drosophila_2:1628642_at:544:85; Interrogation_Position=998; Antisense; AGTGCGACACTGAAGGATGCGACAA

Paste this into a BLAST search page for me
GTGTACACCAAGAGTTCGCACCTCATTCGCACCTCAAGGCGCACAAAAGGTACAGGTGAGAAGCCGTACGTGTGCGAGGGCTGCATCTGGCGCTTCGCTCGGTCGGATGAGCTGACCCGGCACTAATGCAGGACTACGAGAGCAAGTTCTCAAGTTCTCGTTGCTGAGTCTGTTCGAGTCTGTTCAAGAATCCCTACAAGAATCCCTACAAGTTTGCCGGCGGAGAGCTGGAAGAGCTACGCCGGATCAGTAACAGCAGCTTCAGTGGGATTAACAACGGCGGCTACAATGATCTCTCCATGATCTCTCCAAGAACCGCAAGGTGAGTGCGACACTGAAGGATGCGACAA

Full Affymetrix probeset data:

Annotations for 1628642_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720