FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628643_at:

>probe:Drosophila_2:1628643_at:431:453; Interrogation_Position=244; Antisense; GATCAGTGGGTCATCACCGCGGCTA
>probe:Drosophila_2:1628643_at:150:437; Interrogation_Position=358; Antisense; GAGGATATCGTCATGCACTGCAACT
>probe:Drosophila_2:1628643_at:337:399; Interrogation_Position=385; Antisense; GACAGCCCCATGTACCATAATGACA
>probe:Drosophila_2:1628643_at:212:9; Interrogation_Position=409; Antisense; ATTGCCCTGATCAAGACGCATGCAC
>probe:Drosophila_2:1628643_at:324:411; Interrogation_Position=423; Antisense; GACGCATGCACTATTCGATTACGAT
>probe:Drosophila_2:1628643_at:195:365; Interrogation_Position=459; Antisense; GAATATCACAATCGCTCCGTTGGAG
>probe:Drosophila_2:1628643_at:284:551; Interrogation_Position=541; Antisense; GGAGATTTCTCATGGCAGCTGCAGC
>probe:Drosophila_2:1628643_at:55:61; Interrogation_Position=572; Antisense; ATGTAACCTATGTCGCGCCGGAAAA
>probe:Drosophila_2:1628643_at:522:219; Interrogation_Position=595; Antisense; AAGTGCAATGCCACGTACGGCGGTA
>probe:Drosophila_2:1628643_at:591:485; Interrogation_Position=609; Antisense; GTACGGCGGTACTCCAGATCTGGAT
>probe:Drosophila_2:1628643_at:458:593; Interrogation_Position=635; Antisense; TGGGTCACCTTTGTGCCGTGGGAAA
>probe:Drosophila_2:1628643_at:278:549; Interrogation_Position=691; Antisense; GGAGGACCCATCGTTGACAGTCGTG
>probe:Drosophila_2:1628643_at:200:675; Interrogation_Position=757; Antisense; TATGGATTTCCCGATGTTTTTGCCC
>probe:Drosophila_2:1628643_at:534:721; Interrogation_Position=776; Antisense; TTGCCCGCATTAGCTTTTACTACAG

Paste this into a BLAST search page for me
GATCAGTGGGTCATCACCGCGGCTAGAGGATATCGTCATGCACTGCAACTGACAGCCCCATGTACCATAATGACAATTGCCCTGATCAAGACGCATGCACGACGCATGCACTATTCGATTACGATGAATATCACAATCGCTCCGTTGGAGGGAGATTTCTCATGGCAGCTGCAGCATGTAACCTATGTCGCGCCGGAAAAAAGTGCAATGCCACGTACGGCGGTAGTACGGCGGTACTCCAGATCTGGATTGGGTCACCTTTGTGCCGTGGGAAAGGAGGACCCATCGTTGACAGTCGTGTATGGATTTCCCGATGTTTTTGCCCTTGCCCGCATTAGCTTTTACTACAG

Full Affymetrix probeset data:

Annotations for 1628643_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720