FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628644_at:

>probe:Drosophila_2:1628644_at:554:67; Interrogation_Position=1020; Antisense; ATGGCAAGTTGGAGCGGCCTTTCTC
>probe:Drosophila_2:1628644_at:319:415; Interrogation_Position=1031; Antisense; GAGCGGCCTTTCTCCTGAGGAAAAG
>probe:Drosophila_2:1628644_at:546:687; Interrogation_Position=1183; Antisense; TATTTTGAACCCTTTTTCGCTGACA
>probe:Drosophila_2:1628644_at:103:427; Interrogation_Position=708; Antisense; GAGGTGGCTACCAGGGCTCCAATCG
>probe:Drosophila_2:1628644_at:193:289; Interrogation_Position=733; Antisense; CGGCGACTACTATCCGCAGTACTAT
>probe:Drosophila_2:1628644_at:45:351; Interrogation_Position=748; Antisense; GCAGTACTATCACGGCAACGTCTAT
>probe:Drosophila_2:1628644_at:141:331; Interrogation_Position=777; Antisense; GCGGAAGTTCCGATGCAGGCAGCAT
>probe:Drosophila_2:1628644_at:498:73; Interrogation_Position=806; Antisense; AGGAACGGCGAGACCTGGACGCACT
>probe:Drosophila_2:1628644_at:118:691; Interrogation_Position=840; Antisense; TTTGGACCACGGAGCGAGTGCCGCA
>probe:Drosophila_2:1628644_at:559:113; Interrogation_Position=867; Antisense; AGCAGGGACAGATCTATCGGCGGCC
>probe:Drosophila_2:1628644_at:599:585; Interrogation_Position=896; Antisense; TGGAAGCCCTGCTACTGCATGTCAT
>probe:Drosophila_2:1628644_at:532:599; Interrogation_Position=915; Antisense; TGTCATCCACGGAGTTCAGACGCCG
>probe:Drosophila_2:1628644_at:12:105; Interrogation_Position=932; Antisense; AGACGCCGTCGGGATAGCAAAGCCA
>probe:Drosophila_2:1628644_at:581:349; Interrogation_Position=964; Antisense; GCAGACGGATCAGCACAACAAGGGT

Paste this into a BLAST search page for me
ATGGCAAGTTGGAGCGGCCTTTCTCGAGCGGCCTTTCTCCTGAGGAAAAGTATTTTGAACCCTTTTTCGCTGACAGAGGTGGCTACCAGGGCTCCAATCGCGGCGACTACTATCCGCAGTACTATGCAGTACTATCACGGCAACGTCTATGCGGAAGTTCCGATGCAGGCAGCATAGGAACGGCGAGACCTGGACGCACTTTTGGACCACGGAGCGAGTGCCGCAAGCAGGGACAGATCTATCGGCGGCCTGGAAGCCCTGCTACTGCATGTCATTGTCATCCACGGAGTTCAGACGCCGAGACGCCGTCGGGATAGCAAAGCCAGCAGACGGATCAGCACAACAAGGGT

Full Affymetrix probeset data:

Annotations for 1628644_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720