FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628645_at:

>probe:Drosophila_2:1628645_at:488:625; Interrogation_Position=1212; Antisense; TGCCTTCGAGGCCATAATTCCCAAA
>probe:Drosophila_2:1628645_at:592:245; Interrogation_Position=1227; Antisense; AATTCCCAAACAGGTTCGCGATGCC
>probe:Drosophila_2:1628645_at:561:505; Interrogation_Position=1341; Antisense; GTGCCTTCACATTCTGAGCATCAAG
>probe:Drosophila_2:1628645_at:669:107; Interrogation_Position=1364; Antisense; AGAACTTCTGGCACGATATCCATCG
>probe:Drosophila_2:1628645_at:197:625; Interrogation_Position=1424; Antisense; TGCCCACGTATCTCTATCGATTCGA
>probe:Drosophila_2:1628645_at:591:9; Interrogation_Position=1454; Antisense; ATTCGCCACACTTTAATCACTATCG
>probe:Drosophila_2:1628645_at:579:505; Interrogation_Position=1512; Antisense; GTGCCATGCGGATGACATTTCCTAC
>probe:Drosophila_2:1628645_at:35:603; Interrogation_Position=1538; Antisense; TGTTCTACGGCATACTCTCCAGTAA
>probe:Drosophila_2:1628645_at:175:517; Interrogation_Position=1606; Antisense; GTGGGCATGTGGACATCTTTCGCCA
>probe:Drosophila_2:1628645_at:629:131; Interrogation_Position=1633; Antisense; ACCGGAGATCCCAACTGTGAGATAA
>probe:Drosophila_2:1628645_at:542:607; Interrogation_Position=1650; Antisense; TGAGATAATCGCTCCCGTCAAGTGG
>probe:Drosophila_2:1628645_at:101:389; Interrogation_Position=1699; Antisense; GAAAACTGCCTTAACATTGCCGATG
>probe:Drosophila_2:1628645_at:458:7; Interrogation_Position=1714; Antisense; ATTGCCGATGGCCTGGAGTTCATTC
>probe:Drosophila_2:1628645_at:325:697; Interrogation_Position=1778; Antisense; TTTACACCAGGGAAAGCCTCTACTA

Paste this into a BLAST search page for me
TGCCTTCGAGGCCATAATTCCCAAAAATTCCCAAACAGGTTCGCGATGCCGTGCCTTCACATTCTGAGCATCAAGAGAACTTCTGGCACGATATCCATCGTGCCCACGTATCTCTATCGATTCGAATTCGCCACACTTTAATCACTATCGGTGCCATGCGGATGACATTTCCTACTGTTCTACGGCATACTCTCCAGTAAGTGGGCATGTGGACATCTTTCGCCAACCGGAGATCCCAACTGTGAGATAATGAGATAATCGCTCCCGTCAAGTGGGAAAACTGCCTTAACATTGCCGATGATTGCCGATGGCCTGGAGTTCATTCTTTACACCAGGGAAAGCCTCTACTA

Full Affymetrix probeset data:

Annotations for 1628645_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720