Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628646_at:

>probe:Drosophila_2:1628646_at:534:603; Interrogation_Position=1641; Antisense; TGTTCCTGCGCTACGGATCCCGATG
>probe:Drosophila_2:1628646_at:671:125; Interrogation_Position=1710; Antisense; AGCCGGGACGCCACTGCGGACAGTT
>probe:Drosophila_2:1628646_at:174:507; Interrogation_Position=1738; Antisense; GTGCCCCTGCCAGTACATCAAAGAG
>probe:Drosophila_2:1628646_at:686:213; Interrogation_Position=1758; Antisense; AAGAGCACCTGCAGTGCAAACCGCG
>probe:Drosophila_2:1628646_at:60:177; Interrogation_Position=1775; Antisense; AAACCGCGAGGCAAGTTCAAGTGTT
>probe:Drosophila_2:1628646_at:685:533; Interrogation_Position=1816; Antisense; GGTGATGGCATCTGAACGCTACGAT
>probe:Drosophila_2:1628646_at:362:165; Interrogation_Position=1851; Antisense; AAATCTTGTTGTTCTTGTGAATGTC
>probe:Drosophila_2:1628646_at:349:511; Interrogation_Position=1867; Antisense; GTGAATGTCTGTGTGCTGTAACTAA
>probe:Drosophila_2:1628646_at:682:425; Interrogation_Position=1903; Antisense; GAGAGGCTTTGTTTGGAACCCATGA
>probe:Drosophila_2:1628646_at:269:249; Interrogation_Position=1938; Antisense; CAATCCTACAATCGCGTGATGCTAC
>probe:Drosophila_2:1628646_at:329:279; Interrogation_Position=1976; Antisense; CTACTTTTCCACCTATTATGCCAAT
>probe:Drosophila_2:1628646_at:191:705; Interrogation_Position=1991; Antisense; TTATGCCAATGATCGACTCTCTTTC
>probe:Drosophila_2:1628646_at:62:45; Interrogation_Position=2002; Antisense; ATCGACTCTCTTTCGTTTCAGATGT
>probe:Drosophila_2:1628646_at:355:637; Interrogation_Position=2014; Antisense; TCGTTTCAGATGTTAGCCCCTAGGG

Paste this into a BLAST search page for me
TGTTCCTGCGCTACGGATCCCGATGAGCCGGGACGCCACTGCGGACAGTTGTGCCCCTGCCAGTACATCAAAGAGAAGAGCACCTGCAGTGCAAACCGCGAAACCGCGAGGCAAGTTCAAGTGTTGGTGATGGCATCTGAACGCTACGATAAATCTTGTTGTTCTTGTGAATGTCGTGAATGTCTGTGTGCTGTAACTAAGAGAGGCTTTGTTTGGAACCCATGACAATCCTACAATCGCGTGATGCTACCTACTTTTCCACCTATTATGCCAATTTATGCCAATGATCGACTCTCTTTCATCGACTCTCTTTCGTTTCAGATGTTCGTTTCAGATGTTAGCCCCTAGGG

Full Affymetrix probeset data:

Annotations for 1628646_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime