FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628647_at:

>probe:Drosophila_2:1628647_at:452:161; Interrogation_Position=142; Antisense; AAATTTTGGATGAGCCTCCGAGGGA
>probe:Drosophila_2:1628647_at:261:81; Interrogation_Position=208; Antisense; AGGGCAAGACCTATACTCCGACGGA
>probe:Drosophila_2:1628647_at:554:553; Interrogation_Position=230; Antisense; GGAGCTCAAGTTCCAGCCGAGACTC
>probe:Drosophila_2:1628647_at:562:561; Interrogation_Position=259; Antisense; GGAACGCGGATCCTGAGTCCTTCTA
>probe:Drosophila_2:1628647_at:313:599; Interrogation_Position=300; Antisense; TGTCCCGATGCTCCGAACCGAGAGA
>probe:Drosophila_2:1628647_at:248:399; Interrogation_Position=319; Antisense; GAGAGAATCCCATGTACCGTTCCTG
>probe:Drosophila_2:1628647_at:95:583; Interrogation_Position=351; Antisense; TGGCTGGTGGTCAATGTTCCCGGAT
>probe:Drosophila_2:1628647_at:34:459; Interrogation_Position=398; Antisense; GATATCGGAGTACTTCGGTCCTCTG
>probe:Drosophila_2:1628647_at:708:535; Interrogation_Position=414; Antisense; GGTCCTCTGCCTCCAAAGGATAGTG
>probe:Drosophila_2:1628647_at:346:263; Interrogation_Position=444; Antisense; CAGCGGTATCTTATTCTTGTGTATC
>probe:Drosophila_2:1628647_at:508:553; Interrogation_Position=506; Antisense; GGAGCTTAGCAATGCCGATGGTCAT
>probe:Drosophila_2:1628647_at:60:65; Interrogation_Position=570; Antisense; ATGGGCTCACCAGTGGCGGGTAATA
>probe:Drosophila_2:1628647_at:427:329; Interrogation_Position=585; Antisense; GCGGGTAATATATTCCAGTCCAGGT
>probe:Drosophila_2:1628647_at:536:363; Interrogation_Position=615; Antisense; GAATATGTGCCCGAGTTGATGAAGA

Paste this into a BLAST search page for me
AAATTTTGGATGAGCCTCCGAGGGAAGGGCAAGACCTATACTCCGACGGAGGAGCTCAAGTTCCAGCCGAGACTCGGAACGCGGATCCTGAGTCCTTCTATGTCCCGATGCTCCGAACCGAGAGAGAGAGAATCCCATGTACCGTTCCTGTGGCTGGTGGTCAATGTTCCCGGATGATATCGGAGTACTTCGGTCCTCTGGGTCCTCTGCCTCCAAAGGATAGTGCAGCGGTATCTTATTCTTGTGTATCGGAGCTTAGCAATGCCGATGGTCATATGGGCTCACCAGTGGCGGGTAATAGCGGGTAATATATTCCAGTCCAGGTGAATATGTGCCCGAGTTGATGAAGA

Full Affymetrix probeset data:

Annotations for 1628647_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720