FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628648_at:

>probe:Drosophila_2:1628648_at:601:453; Interrogation_Position=1009; Antisense; GATATAGCCCCGGAAACGACAAGGT
>probe:Drosophila_2:1628648_at:524:81; Interrogation_Position=1030; Antisense; AGGTGGCCTCTGCTTCTGAGGACAA
>probe:Drosophila_2:1628648_at:207:503; Interrogation_Position=1055; Antisense; GTCCCTGAACATATACTACTGTCCG
>probe:Drosophila_2:1628648_at:28:407; Interrogation_Position=543; Antisense; GACGGCAAAATCTCCATGTACAGTG
>probe:Drosophila_2:1628648_at:441:241; Interrogation_Position=613; Antisense; AATACACGCTTAGCATTGCCTACAG
>probe:Drosophila_2:1628648_at:478:667; Interrogation_Position=633; Antisense; TACAGTCCCGATGGCAAGTACATTG
>probe:Drosophila_2:1628648_at:521:13; Interrogation_Position=681; Antisense; ATTACCATTTTCGATGTGGCCGCGG
>probe:Drosophila_2:1628648_at:136:449; Interrogation_Position=737; Antisense; GATGCCAGTGCGTAGCCTTTGCTTT
>probe:Drosophila_2:1628648_at:181:651; Interrogation_Position=784; Antisense; TCACTGCCTCAGATGATGGTCACAT
>probe:Drosophila_2:1628648_at:333:377; Interrogation_Position=809; Antisense; GAAGCTTTATGATGTAACCCACTCC
>probe:Drosophila_2:1628648_at:355:521; Interrogation_Position=879; Antisense; GTGGCATTCTCCGAGGACGGCAAAC
>probe:Drosophila_2:1628648_at:444:117; Interrogation_Position=912; Antisense; AGCTCCTCCAGTGATAACAGCGTGA
>probe:Drosophila_2:1628648_at:199:25; Interrogation_Position=939; Antisense; ATATGGGACACCTCGGAACGCAAGT
>probe:Drosophila_2:1628648_at:416:469; Interrogation_Position=974; Antisense; GTTCGCCGAGCACACAGATCAGGTG

Paste this into a BLAST search page for me
GATATAGCCCCGGAAACGACAAGGTAGGTGGCCTCTGCTTCTGAGGACAAGTCCCTGAACATATACTACTGTCCGGACGGCAAAATCTCCATGTACAGTGAATACACGCTTAGCATTGCCTACAGTACAGTCCCGATGGCAAGTACATTGATTACCATTTTCGATGTGGCCGCGGGATGCCAGTGCGTAGCCTTTGCTTTTCACTGCCTCAGATGATGGTCACATGAAGCTTTATGATGTAACCCACTCCGTGGCATTCTCCGAGGACGGCAAACAGCTCCTCCAGTGATAACAGCGTGAATATGGGACACCTCGGAACGCAAGTGTTCGCCGAGCACACAGATCAGGTG

Full Affymetrix probeset data:

Annotations for 1628648_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720