FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628649_at:

>probe:Drosophila_2:1628649_at:335:513; Interrogation_Position=109; Antisense; GTGATCCACATCAATAGTCCCAGCG
>probe:Drosophila_2:1628649_at:473:33; Interrogation_Position=118; Antisense; ATCAATAGTCCCAGCGCCGCAAAGT
>probe:Drosophila_2:1628649_at:82:125; Interrogation_Position=130; Antisense; AGCGCCGCAAAGTAAATGAGCTTTT
>probe:Drosophila_2:1628649_at:97:57; Interrogation_Position=145; Antisense; ATGAGCTTTTGATAATTGCAGGCAC
>probe:Drosophila_2:1628649_at:216:117; Interrogation_Position=148; Antisense; AGCTTTTGATAATTGCAGGCACAGA
>probe:Drosophila_2:1628649_at:220:349; Interrogation_Position=162; Antisense; GCAGGCACAGAATTCAATAAAACAT
>probe:Drosophila_2:1628649_at:414:53; Interrogation_Position=22; Antisense; ATGAAGATCACCTCTGCACTTGTTC
>probe:Drosophila_2:1628649_at:413:97; Interrogation_Position=26; Antisense; AGATCACCTCTGCACTTGTTCTGCT
>probe:Drosophila_2:1628649_at:704:149; Interrogation_Position=39; Antisense; ACTTGTTCTGCTCTTTGCCGGTGTG
>probe:Drosophila_2:1628649_at:522:277; Interrogation_Position=51; Antisense; CTTTGCCGGTGTGGCTTTCGCCCAA
>probe:Drosophila_2:1628649_at:55:521; Interrogation_Position=61; Antisense; GTGGCTTTCGCCCAATCTGCGGATC
>probe:Drosophila_2:1628649_at:587:39; Interrogation_Position=75; Antisense; ATCTGCGGATCCGAACACCAACGAA
>probe:Drosophila_2:1628649_at:86:543; Interrogation_Position=81; Antisense; GGATCCGAACACCAACGAAAACAAG
>probe:Drosophila_2:1628649_at:263:137; Interrogation_Position=95; Antisense; ACGAAAACAAGAATGTGATCCACAT

Paste this into a BLAST search page for me
GTGATCCACATCAATAGTCCCAGCGATCAATAGTCCCAGCGCCGCAAAGTAGCGCCGCAAAGTAAATGAGCTTTTATGAGCTTTTGATAATTGCAGGCACAGCTTTTGATAATTGCAGGCACAGAGCAGGCACAGAATTCAATAAAACATATGAAGATCACCTCTGCACTTGTTCAGATCACCTCTGCACTTGTTCTGCTACTTGTTCTGCTCTTTGCCGGTGTGCTTTGCCGGTGTGGCTTTCGCCCAAGTGGCTTTCGCCCAATCTGCGGATCATCTGCGGATCCGAACACCAACGAAGGATCCGAACACCAACGAAAACAAGACGAAAACAAGAATGTGATCCACAT

Full Affymetrix probeset data:

Annotations for 1628649_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720