FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628650_at:

>probe:Drosophila_2:1628650_at:522:585; Interrogation_Position=1577; Antisense; TGGAACTGCAAACCAGGCCGTCGAA
>probe:Drosophila_2:1628650_at:37:195; Interrogation_Position=1677; Antisense; AACTCCAGAGAGTCCAATTGGCCGT
>probe:Drosophila_2:1628650_at:400:431; Interrogation_Position=1740; Antisense; GAGTCTCGCCTTCAAACTGAGCGCA
>probe:Drosophila_2:1628650_at:467:437; Interrogation_Position=1793; Antisense; GAGGCGAACCACCAAGAACTCGATG
>probe:Drosophila_2:1628650_at:125:295; Interrogation_Position=1813; Antisense; CGATGGAGACTGAAACCGCCGCGGA
>probe:Drosophila_2:1628650_at:440:23; Interrogation_Position=1846; Antisense; ATATCGCTATGTCGCCAGGTTACAA
>probe:Drosophila_2:1628650_at:167:89; Interrogation_Position=1876; Antisense; AGTCGGCAGTCCAACGCCTGGGAAA
>probe:Drosophila_2:1628650_at:407:187; Interrogation_Position=1932; Antisense; AACAGCTACTGAGTCTCCAAGTTCC
>probe:Drosophila_2:1628650_at:384:249; Interrogation_Position=1949; Antisense; CAAGTTCCATCGCAGGTGTGAGGTC
>probe:Drosophila_2:1628650_at:447:511; Interrogation_Position=1974; Antisense; GTGACCTCTGCCTTCTGAAAATTCA
>probe:Drosophila_2:1628650_at:340:7; Interrogation_Position=1994; Antisense; ATTCACTCTAATTCCGATTCACGGT
>probe:Drosophila_2:1628650_at:622:461; Interrogation_Position=2009; Antisense; GATTCACGGTCATAATTCTCCCGGT
>probe:Drosophila_2:1628650_at:420:389; Interrogation_Position=2043; Antisense; GAAACTTTTACATTCGCTGTCAAAA
>probe:Drosophila_2:1628650_at:56:249; Interrogation_Position=2085; Antisense; AATTGAGGCCCGGAAATCCTGCTGG

Paste this into a BLAST search page for me
TGGAACTGCAAACCAGGCCGTCGAAAACTCCAGAGAGTCCAATTGGCCGTGAGTCTCGCCTTCAAACTGAGCGCAGAGGCGAACCACCAAGAACTCGATGCGATGGAGACTGAAACCGCCGCGGAATATCGCTATGTCGCCAGGTTACAAAGTCGGCAGTCCAACGCCTGGGAAAAACAGCTACTGAGTCTCCAAGTTCCCAAGTTCCATCGCAGGTGTGAGGTCGTGACCTCTGCCTTCTGAAAATTCAATTCACTCTAATTCCGATTCACGGTGATTCACGGTCATAATTCTCCCGGTGAAACTTTTACATTCGCTGTCAAAAAATTGAGGCCCGGAAATCCTGCTGG

Full Affymetrix probeset data:

Annotations for 1628650_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720