Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628655_at:

>probe:Drosophila_2:1628655_at:122:403; Interrogation_Position=1857; Antisense; GACTTCAAATTACTATCGGATCTGT
>probe:Drosophila_2:1628655_at:466:451; Interrogation_Position=1875; Antisense; GATCTGTTGGTCCATTGTTACTCCT
>probe:Drosophila_2:1628655_at:223:475; Interrogation_Position=1891; Antisense; GTTACTCCTTTGGTTATGTTGGTCA
>probe:Drosophila_2:1628655_at:330:681; Interrogation_Position=1905; Antisense; TATGTTGGTCATCCTGGTGTACAGC
>probe:Drosophila_2:1628655_at:363:533; Interrogation_Position=1920; Antisense; GGTGTACAGCTTGCTTACCATGCGT
>probe:Drosophila_2:1628655_at:553:51; Interrogation_Position=1939; Antisense; ATGCGTCCACTCAGCTATAATGGTC
>probe:Drosophila_2:1628655_at:512:601; Interrogation_Position=2001; Antisense; TGTATCGGGCTGTATTATTGGCCAG
>probe:Drosophila_2:1628655_at:521:691; Interrogation_Position=2016; Antisense; TATTGGCCAGCTGTTCTACTGGGCA
>probe:Drosophila_2:1628655_at:350:277; Interrogation_Position=2031; Antisense; CTACTGGGCAGGTTATGCAAACTTC
>probe:Drosophila_2:1628655_at:249:375; Interrogation_Position=2076; Antisense; GAAGAGTCGCATTAACAATTCCATT
>probe:Drosophila_2:1628655_at:595:245; Interrogation_Position=2091; Antisense; CAATTCCATTAAGCCGCATTCCGAT
>probe:Drosophila_2:1628655_at:69:521; Interrogation_Position=2119; Antisense; GGGCCTTCGGATCCCAAAAAGCTGA
>probe:Drosophila_2:1628655_at:2:475; Interrogation_Position=2194; Antisense; GTTAATCGCCGTTGTGTTTGCTACA
>probe:Drosophila_2:1628655_at:490:59; Interrogation_Position=2291; Antisense; ATGTTTCTCATTTAATACTGCTTAG

Paste this into a BLAST search page for me
GACTTCAAATTACTATCGGATCTGTGATCTGTTGGTCCATTGTTACTCCTGTTACTCCTTTGGTTATGTTGGTCATATGTTGGTCATCCTGGTGTACAGCGGTGTACAGCTTGCTTACCATGCGTATGCGTCCACTCAGCTATAATGGTCTGTATCGGGCTGTATTATTGGCCAGTATTGGCCAGCTGTTCTACTGGGCACTACTGGGCAGGTTATGCAAACTTCGAAGAGTCGCATTAACAATTCCATTCAATTCCATTAAGCCGCATTCCGATGGGCCTTCGGATCCCAAAAAGCTGAGTTAATCGCCGTTGTGTTTGCTACAATGTTTCTCATTTAATACTGCTTAG

Full Affymetrix probeset data:

Annotations for 1628655_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime