FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628656_at:

>probe:Drosophila_2:1628656_at:646:249; Interrogation_Position=102; Antisense; CACGGAGTGTCCAACGGACTCGTTT
>probe:Drosophila_2:1628656_at:238:555; Interrogation_Position=117; Antisense; GGACTCGTTTCGATGCAACAATGGC
>probe:Drosophila_2:1628656_at:187:229; Interrogation_Position=136; Antisense; AATGGCAAGTGCATCTCGCACCACT
>probe:Drosophila_2:1628656_at:232:261; Interrogation_Position=154; Antisense; CACCACTGGGTCTGCAATTATCAAA
>probe:Drosophila_2:1628656_at:660:33; Interrogation_Position=173; Antisense; ATCAAAAGGACTGCGACGATGGCGA
>probe:Drosophila_2:1628656_at:615:57; Interrogation_Position=200; Antisense; ATGAGATGCAGTCGTGCCCTCCACC
>probe:Drosophila_2:1628656_at:431:261; Interrogation_Position=221; Antisense; CACCGGAATGCGAAACGCCGCAGTT
>probe:Drosophila_2:1628656_at:432:247; Interrogation_Position=247; Antisense; AATTGCGGGCAGTACACGTTCAACA
>probe:Drosophila_2:1628656_at:73:139; Interrogation_Position=262; Antisense; ACGTTCAACAAGACCTACTGCATCC
>probe:Drosophila_2:1628656_at:269:321; Interrogation_Position=27; Antisense; GCCCTGGCCCCAAAAACTGAACAGT
>probe:Drosophila_2:1628656_at:691:277; Interrogation_Position=294; Antisense; CTATCGCTGCGATATGATCGAGGAT
>probe:Drosophila_2:1628656_at:174:57; Interrogation_Position=335; Antisense; ATGAGGCGCAGTGCAGCGCTCGCAT
>probe:Drosophila_2:1628656_at:699:177; Interrogation_Position=40; Antisense; AAACTGAACAGTCGACCCCGTGGCA
>probe:Drosophila_2:1628656_at:314:263; Interrogation_Position=87; Antisense; CAGCAGTGGCATCAACACGGAGTGT

Paste this into a BLAST search page for me
CACGGAGTGTCCAACGGACTCGTTTGGACTCGTTTCGATGCAACAATGGCAATGGCAAGTGCATCTCGCACCACTCACCACTGGGTCTGCAATTATCAAAATCAAAAGGACTGCGACGATGGCGAATGAGATGCAGTCGTGCCCTCCACCCACCGGAATGCGAAACGCCGCAGTTAATTGCGGGCAGTACACGTTCAACAACGTTCAACAAGACCTACTGCATCCGCCCTGGCCCCAAAAACTGAACAGTCTATCGCTGCGATATGATCGAGGATATGAGGCGCAGTGCAGCGCTCGCATAAACTGAACAGTCGACCCCGTGGCACAGCAGTGGCATCAACACGGAGTGT

Full Affymetrix probeset data:

Annotations for 1628656_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720